![]() |
||||||
|
![]() | Fusion Gene Summary |
![]() | Fusion Gene ORF analysis |
![]() | Fusion Genomic Features |
![]() | Fusion Protein Features |
![]() | Fusion Gene Sequence |
![]() | Fusion Gene PPI analysis |
![]() | Related Drugs |
![]() | Related Diseases |
Fusion gene:DSP-LY86 (FusionGDB2 ID:HG1832TG9450) |
Fusion Gene Summary for DSP-LY86 |
![]() |
Fusion gene information | Fusion gene name: DSP-LY86 | Fusion gene ID: hg1832tg9450 | Hgene | Tgene | Gene symbol | DSP | LY86 | Gene ID | 1832 | 9450 |
Gene name | desmoplakin | lymphocyte antigen 86 | |
Synonyms | DCWHKTA|DP | MD-1|MD1|MMD-1|dJ80N2.1 | |
Cytomap | ('DSP')('LY86') 6p24.3 | 6p25.1 | |
Type of gene | protein-coding | protein-coding | |
Description | desmoplakin250/210 kDa paraneoplastic pemphigus antigen | lymphocyte antigen 86MD-1, RP105-associatedly-86protein MD-1 | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | P15924 | . | |
Ensembl transtripts involved in fusion gene | ENST00000379802, ENST00000418664, | ||
Fusion gene scores | * DoF score | 16 X 19 X 11=3344 | 2 X 5 X 2=20 |
# samples | 22 | 4 | |
** MAII score | log2(22/3344*10)=-3.92599941855622 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/20*10)=1 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Context | PubMed: DSP [Title/Abstract] AND LY86 [Title/Abstract] AND fusion [Title/Abstract] | ||
Most frequent breakpoint | DSP(7542318)-LY86(6649858), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | DSP-LY86 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DSP-LY86 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DSP-LY86 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | DSP | GO:0018149 | peptide cross-linking | 10908733 |
Hgene | DSP | GO:0030216 | keratinocyte differentiation | 10908733 |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * All genome coordinats were lifted-over on hg19. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
Source | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
ChimerDB4 | ESCA | TCGA-JY-A6FD-01A | DSP | chr6 | 7542318 | - | LY86 | chr6 | 6649858 | + |
ChimerDB4 | ESCA | TCGA-JY-A6FD-01A | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649858 | + |
ChimerDB4 | ESCA | TCGA-JY-A6FD | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + |
ChimerDB4 | ESCA | TCGA-JY-A6FD | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649858 | + |
ChimerDB4 | ESCA | TCGA-JY-A6FD | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649863 | + |
ChimerDB4 | ESCA | TCGA-JY-A6FD | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + |
Top |
Fusion Gene ORF analysis for DSP-LY86 |
![]() * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
ORF | Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
Frame-shift | ENST00000379802 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649858 | + |
Frame-shift | ENST00000379802 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + |
Frame-shift | ENST00000379802 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649863 | + |
Frame-shift | ENST00000379802 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649858 | + |
Frame-shift | ENST00000379802 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + |
Frame-shift | ENST00000379802 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649863 | + |
Frame-shift | ENST00000379802 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + |
Frame-shift | ENST00000418664 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649858 | + |
Frame-shift | ENST00000418664 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + |
Frame-shift | ENST00000418664 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649863 | + |
Frame-shift | ENST00000418664 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649858 | + |
Frame-shift | ENST00000418664 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + |
Frame-shift | ENST00000418664 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649863 | + |
Frame-shift | ENST00000418664 | ENST00000379953 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + |
In-frame | ENST00000379802 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + |
In-frame | ENST00000418664 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000379802 | DSP | chr6 | 7542318 | + | ENST00000230568 | LY86 | chr6 | 6654776 | + | 599 | 511 | 390 | 1 | 130 |
ENST00000418664 | DSP | chr6 | 7542318 | + | ENST00000230568 | LY86 | chr6 | 6654776 | + | 557 | 469 | 348 | 1 | 116 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000379802 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + | 0.21879657 | 0.78120345 |
ENST00000418664 | ENST00000230568 | DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + | 0.3800372 | 0.6199628 |
Top |
Fusion Genomic Features for DSP-LY86 |
![]() |
Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | 1-p | p (fusion gene breakpoint) |
DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + | 1.99E-05 | 0.9999801 |
DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + | 8.16E-06 | 0.9999919 |
DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + | 8.16E-06 | 0.9999919 |
DSP | chr6 | 7542318 | + | LY86 | chr6 | 6654776 | + | 1.99E-05 | 0.9999801 |
DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + | 8.16E-06 | 0.9999919 |
DSP | chr6 | 7542318 | + | LY86 | chr6 | 6649857 | + | 8.16E-06 | 0.9999919 |
![]() |
![]() |
![]() |
![]() |
Top |
Fusion Protein Features for DSP-LY86 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:7542318/chr6:6649858) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
Hgene | Tgene |
DSP | . |
FUNCTION: Major high molecular weight protein of desmosomes. Involved in the organization of the desmosomal cadherin-plakoglobin complexes into discrete plasma membrane domains and in the anchoring of intermediate filaments to the desmosomes. | FUNCTION: Transcriptional activator which is required for calcium-dependent dendritic growth and branching in cortical neurons. Recruits CREB-binding protein (CREBBP) to nuclear bodies. Component of the CREST-BRG1 complex, a multiprotein complex that regulates promoter activation by orchestrating a calcium-dependent release of a repressor complex and a recruitment of an activator complex. In resting neurons, transcription of the c-FOS promoter is inhibited by BRG1-dependent recruitment of a phospho-RB1-HDAC1 repressor complex. Upon calcium influx, RB1 is dephosphorylated by calcineurin, which leads to release of the repressor complex. At the same time, there is increased recruitment of CREBBP to the promoter by a CREST-dependent mechanism, which leads to transcriptional activation. The CREST-BRG1 complex also binds to the NR2B promoter, and activity-dependent induction of NR2B expression involves a release of HDAC1 and recruitment of CREBBP (By similarity). {ECO:0000250}. |
![]() * Minus value of BPloci means that the break pointn is located before the CDS. |
- In-frame and retained protein feature among the 13 regional features. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
- In-frame and not-retained protein feature among the 13 regional features. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 1018_1945 | 56 | 2872.0 | Coiled coil | Ontology_term=ECO:0000255 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 1018_1945 | 56 | 2273.0 | Coiled coil | Ontology_term=ECO:0000255 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 458_515 | 56 | 2872.0 | Domain | SH3 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 458_515 | 56 | 2273.0 | Domain | SH3 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 1057_1945 | 56 | 2872.0 | Region | Note=Central fibrous rod domain |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 1946_2871 | 56 | 2872.0 | Region | Note=Globular 2 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 1960_2208 | 56 | 2872.0 | Region | Note=4.5 X 38 AA tandem repeats (Domain A) |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 1_1056 | 56 | 2872.0 | Region | Note=Globular 1 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2244_2446 | 56 | 2872.0 | Region | Note=4.5 X 38 AA tandem repeats (Domain B) |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2609_2822 | 56 | 2872.0 | Region | Note=4.5 X 38 AA tandem repeats (Domain C) |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2824_2847 | 56 | 2872.0 | Region | Note=6 X 4 AA tandem repeats of G-S-R-[SR] |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 1057_1945 | 56 | 2273.0 | Region | Note=Central fibrous rod domain |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 1946_2871 | 56 | 2273.0 | Region | Note=Globular 2 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 1960_2208 | 56 | 2273.0 | Region | Note=4.5 X 38 AA tandem repeats (Domain A) |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 1_1056 | 56 | 2273.0 | Region | Note=Globular 1 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2244_2446 | 56 | 2273.0 | Region | Note=4.5 X 38 AA tandem repeats (Domain B) |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2609_2822 | 56 | 2273.0 | Region | Note=4.5 X 38 AA tandem repeats (Domain C) |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2824_2847 | 56 | 2273.0 | Region | Note=6 X 4 AA tandem repeats of G-S-R-[SR] |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 178_271 | 56 | 2872.0 | Repeat | Note=Spectrin 1 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2009_2045 | 56 | 2872.0 | Repeat | Note=Plectin 1 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2046_2083 | 56 | 2872.0 | Repeat | Note=Plectin 2 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2084_2121 | 56 | 2872.0 | Repeat | Note=Plectin 3 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2122_2159 | 56 | 2872.0 | Repeat | Note=Plectin 4 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2163_2197 | 56 | 2872.0 | Repeat | Note=Plectin 5 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2198_2233 | 56 | 2872.0 | Repeat | Note=Plectin 6 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2251_2288 | 56 | 2872.0 | Repeat | Note=Plectin 7 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2289_2326 | 56 | 2872.0 | Repeat | Note=Plectin 8 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2327_2364 | 56 | 2872.0 | Repeat | Note=Plectin 9 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2365_2402 | 56 | 2872.0 | Repeat | Note=Plectin 10 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2406_2440 | 56 | 2872.0 | Repeat | Note=Plectin 11 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2456_2493 | 56 | 2872.0 | Repeat | Note=Plectin 12 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2507_2544 | 56 | 2872.0 | Repeat | Note=Plectin 13 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2610_2647 | 56 | 2872.0 | Repeat | Note=Plectin 14 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2648_2685 | 56 | 2872.0 | Repeat | Note=Plectin 15 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2724_2761 | 56 | 2872.0 | Repeat | Note=Plectin 16 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 272_375 | 56 | 2872.0 | Repeat | Note=Spectrin 2 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 2762_2799 | 56 | 2872.0 | Repeat | Note=Plectin 17 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 376_446 | 56 | 2872.0 | Repeat | Note=Spectrin 3a |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 516_545 | 56 | 2872.0 | Repeat | Note=Spectrin 3b |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 546_627 | 56 | 2872.0 | Repeat | Note=Spectrin 4 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 654_769 | 56 | 2872.0 | Repeat | Note=Spectrin 5 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 770_883 | 56 | 2872.0 | Repeat | Note=Spectrin 6 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 178_271 | 56 | 2273.0 | Repeat | Note=Spectrin 1 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2009_2045 | 56 | 2273.0 | Repeat | Note=Plectin 1 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2046_2083 | 56 | 2273.0 | Repeat | Note=Plectin 2 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2084_2121 | 56 | 2273.0 | Repeat | Note=Plectin 3 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2122_2159 | 56 | 2273.0 | Repeat | Note=Plectin 4 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2163_2197 | 56 | 2273.0 | Repeat | Note=Plectin 5 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2198_2233 | 56 | 2273.0 | Repeat | Note=Plectin 6 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2251_2288 | 56 | 2273.0 | Repeat | Note=Plectin 7 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2289_2326 | 56 | 2273.0 | Repeat | Note=Plectin 8 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2327_2364 | 56 | 2273.0 | Repeat | Note=Plectin 9 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2365_2402 | 56 | 2273.0 | Repeat | Note=Plectin 10 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2406_2440 | 56 | 2273.0 | Repeat | Note=Plectin 11 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2456_2493 | 56 | 2273.0 | Repeat | Note=Plectin 12 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2507_2544 | 56 | 2273.0 | Repeat | Note=Plectin 13 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2610_2647 | 56 | 2273.0 | Repeat | Note=Plectin 14 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2648_2685 | 56 | 2273.0 | Repeat | Note=Plectin 15 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2724_2761 | 56 | 2273.0 | Repeat | Note=Plectin 16 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 272_375 | 56 | 2273.0 | Repeat | Note=Spectrin 2 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 2762_2799 | 56 | 2273.0 | Repeat | Note=Plectin 17 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 376_446 | 56 | 2273.0 | Repeat | Note=Spectrin 3a |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 516_545 | 56 | 2273.0 | Repeat | Note=Spectrin 3b |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 546_627 | 56 | 2273.0 | Repeat | Note=Spectrin 4 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 654_769 | 56 | 2273.0 | Repeat | Note=Spectrin 5 |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 770_883 | 56 | 2273.0 | Repeat | Note=Spectrin 6 |
Top |
Fusion Gene Sequence for DSP-LY86 |
![]() |
>24272_24272_1_DSP-LY86_DSP_chr6_7542318_ENST00000379802_LY86_chr6_6654776_ENST00000230568_length(transcript)=599nt_BP=511nt AAGAAACCGGCCAGGTGTGGCCTAGGCGCCCAGTGCCAGCGGGGAGGAGACTCGCTCCGCCGCCGACCAACACCAACACCCAGCTCCGAC GCAGCTCCTCTGCGCCCTTGCCGCCCTCCGAGCCACAGCTTTCCTCCCGCTCCTGCCCCCGGCCCGTCGCCGTCTCCGCGCTCGCAGCGG CCTCGGGAGGGCCCAGGTAGCGAGCAGCGACCTCGCGAGCCTTCCGCACTCCCGCCCGGTTCCCCGGCCGTCCGCCTATCCTTGGCCCCC TCCGCTTTCTCCGCGCCGGCCCGCCTCGCTTATGCCTCGGCGCTGAGCCGCTCTCCCGATTGCCCGCCGACATGAGCTGCAACGGAGGCT CCCACCCGCGGATCAACACTCTGGGCCGCATGATCCGCGCCGAGTCTGGCCCGGACCTGCGCTACGAGGTGACCAGCGGCGGCGGGGGCA CCAGCAGGATGTACTATTCTCGGCGCGGCGTGATCACCGACCAGAACTCGGACGGCTACTGGGAGAATACCAGGTTTTGCTGGAACTGTA >24272_24272_1_DSP-LY86_DSP_chr6_7542318_ENST00000379802_LY86_chr6_6654776_ENST00000230568_length(amino acids)=130AA_BP= MRPRVLIRGWEPPLQLMSAGNRESGSAPRHKRGGPARRKRRGPRIGGRPGNRAGVRKAREVAARYLGPPEAAASAETATGRGQEREESCG -------------------------------------------------------------- >24272_24272_2_DSP-LY86_DSP_chr6_7542318_ENST00000418664_LY86_chr6_6654776_ENST00000230568_length(transcript)=557nt_BP=469nt GGAGGAGACTCGCTCCGCCGCCGACCAACACCAACACCCAGCTCCGACGCAGCTCCTCTGCGCCCTTGCCGCCCTCCGAGCCACAGCTTT CCTCCCGCTCCTGCCCCCGGCCCGTCGCCGTCTCCGCGCTCGCAGCGGCCTCGGGAGGGCCCAGGTAGCGAGCAGCGACCTCGCGAGCCT TCCGCACTCCCGCCCGGTTCCCCGGCCGTCCGCCTATCCTTGGCCCCCTCCGCTTTCTCCGCGCCGGCCCGCCTCGCTTATGCCTCGGCG CTGAGCCGCTCTCCCGATTGCCCGCCGACATGAGCTGCAACGGAGGCTCCCACCCGCGGATCAACACTCTGGGCCGCATGATCCGCGCCG AGTCTGGCCCGGACCTGCGCTACGAGGTGACCAGCGGCGGCGGGGGCACCAGCAGGATGTACTATTCTCGGCGCGGCGTGATCACCGACC AGAACTCGGACGGCTACTGGGAGAATACCAGGTTTTGCTGGAACTGTACACTGAAAAACGGTCCACCGTGGCCTGTGCCAATGCTACTAT >24272_24272_2_DSP-LY86_DSP_chr6_7542318_ENST00000418664_LY86_chr6_6654776_ENST00000230568_length(amino acids)=116AA_BP= MRPRVLIRGWEPPLQLMSAGNRESGSAPRHKRGGPARRKRRGPRIGGRPGNRAGVRKAREVAARYLGPPEAAASAETATGRGQEREESCG -------------------------------------------------------------- |
Top |
Fusion Gene PPI Analysis for DSP-LY86 |
![]() |
![]() |
Hgene | Hgene's interactors | Tgene | Tgene's interactors |
![]() |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Still interaction with |
![]() |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Interaction lost with |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000379802 | + | 1 | 24 | 1_584 | 56.666666666666664 | 2872.0 | plakophilin 1 and junction plakoglobin |
Hgene | DSP | chr6:7542318 | chr6:6654776 | ENST00000418664 | + | 1 | 24 | 1_584 | 56.666666666666664 | 2273.0 | plakophilin 1 and junction plakoglobin |
![]() |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Interaction lost with |
Top |
Related Drugs for DSP-LY86 |
![]() (DrugBank Version 5.1.8 2021-05-08) |
Partner | Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Hgene | DSP | P15924 | DB01593 | Zinc | Small molecule | Approved|Investigational | |
Hgene | DSP | P15924 | DB14487 | Zinc acetate | Small molecule | Approved|Investigational |
Top |
Related Diseases for DSP-LY86 |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | DSP | C1843896 | Arrhythmogenic Right Ventricular Dysplasia, Familial, 8 | 8 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
Hgene | DSP | C1854063 | Cardiomyopathy dilated with Woolly hair and keratoderma | 7 | CTD_human;GENOMICS_ENGLAND;ORPHANET |
Hgene | DSP | C1864826 | Epidermolysis bullosa, lethal acantholytic | 7 | CTD_human;GENOMICS_ENGLAND;ORPHANET |
Hgene | DSP | C1843292 | Skin Fragility-Woolly Hair Syndrome | 6 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
Hgene | DSP | C4014393 | CARDIOMYOPATHY, DILATED, WITH WOOLLY HAIR, KERATODERMA, AND TOOTH AGENESIS | 6 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
Hgene | DSP | C1852127 | KERATOSIS PALMOPLANTARIS STRIATA II | 5 | CTD_human;GENOMICS_ENGLAND |
Hgene | DSP | C0024117 | Chronic Obstructive Airway Disease | 1 | CTD_human |
Hgene | DSP | C0034069 | Pulmonary Fibrosis | 1 | CTD_human |
Hgene | DSP | C0085298 | Sudden Cardiac Death | 1 | CTD_human |
Hgene | DSP | C0085786 | Hamman-Rich syndrome | 1 | ORPHANET |
Hgene | DSP | C1527303 | Chronic Airflow Obstruction | 1 | CTD_human |
Hgene | DSP | C1720824 | Sudden Cardiac Arrest | 1 | CTD_human |
Hgene | DSP | C1800706 | Idiopathic Pulmonary Fibrosis | 1 | CTD_human;ORPHANET |
Hgene | DSP | C3809719 | Severe dermatitis, multiple allergies, metabolic wasting syndrome | 1 | ORPHANET |
Hgene | DSP | C4707237 | Striate palmoplantar keratoderma | 1 | ORPHANET |
Hgene | DSP | C4721507 | Alveolitis, Fibrosing | 1 | CTD_human |
Hgene | DSP | C4721508 | Hamman-Rich Disease | 1 | CTD_human |
Hgene | DSP | C4721509 | Usual Interstitial Pneumonia | 1 | CTD_human |
Hgene | DSP | C4721952 | Familial Idiopathic Pulmonary Fibrosis | 1 | CTD_human |
Tgene | C0006663 | Calcinosis | 1 | CTD_human | |
Tgene | C0018824 | Heart valve disease | 1 | CTD_human | |
Tgene | C0023893 | Liver Cirrhosis, Experimental | 1 | CTD_human | |
Tgene | C0263628 | Tumoral calcinosis | 1 | CTD_human | |
Tgene | C0521174 | Microcalcification | 1 | CTD_human |