![]() |
|||||||
|
Fusion Protein:ZBTB17-MTOR |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ZBTB17-MTOR | FusionPDB ID: 100330 | FusionGDB2.0 ID: 100330 | Hgene | Tgene | Gene symbol | ZBTB17 | MTOR | Gene ID | 7709 | 2475 |
Gene name | zinc finger and BTB domain containing 17 | mechanistic target of rapamycin kinase | |
Synonyms | MIZ-1|ZNF151|ZNF60|pHZ-67 | FRAP|FRAP1|FRAP2|RAFT1|RAPT1|SKS | |
Cytomap | 1p36.13 | 1p36.22 | |
Type of gene | protein-coding | protein-coding | |
Description | zinc finger and BTB domain-containing protein 17Myc-interacting Zn finger protein-1zinc finger protein 151 (pHZ-67)zinc finger protein 60 | serine/threonine-protein kinase mTORFK506 binding protein 12-rapamycin associated protein 2FK506-binding protein 12-rapamycin complex-associated protein 1FKBP-rapamycin associated proteinFKBP12-rapamycin complex-associated protein 1mammalian target o | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | . | TLDC1 Main function of 5'-partner protein: 456 | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000375733, ENST00000375743, ENST00000537142, ENST00000448462, ENST00000479282, | ENST00000376838, ENST00000495435, ENST00000361445, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 8 X 7 X 6=336 | 12 X 11 X 8=1056 |
# samples | 9 | 19 | |
** MAII score | log2(9/336*10)=-1.90046432644909 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(19/1056*10)=-2.47453851102751 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ZBTB17 [Title/Abstract] AND MTOR [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ZBTB17 [Title/Abstract] AND MTOR [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ZBTB17(16269559)-MTOR(11227574), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ZBTB17-MTOR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZBTB17-MTOR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZBTB17-MTOR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZBTB17-MTOR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ZBTB17 | GO:0008285 | negative regulation of cell proliferation | 19160485 |
Hgene | ZBTB17 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 9312026 |
Hgene | ZBTB17 | GO:0071158 | positive regulation of cell cycle arrest | 19160485 |
Tgene | MTOR | GO:0001558 | regulation of cell growth | 18762023 |
Tgene | MTOR | GO:0001934 | positive regulation of protein phosphorylation | 20233713 |
Tgene | MTOR | GO:0006468 | protein phosphorylation | 12150926|15467718|18925875 |
Tgene | MTOR | GO:0009267 | cellular response to starvation | 28223137 |
Tgene | MTOR | GO:0010507 | negative regulation of autophagy | 30704899 |
Tgene | MTOR | GO:0016242 | negative regulation of macroautophagy | 25327288 |
Tgene | MTOR | GO:0016310 | phosphorylation | 11853878|25327288 |
Tgene | MTOR | GO:0031667 | response to nutrient levels | 29750193 |
Tgene | MTOR | GO:0034198 | cellular response to amino acid starvation | 22424946 |
Tgene | MTOR | GO:0038202 | TORC1 signaling | 28223137 |
Tgene | MTOR | GO:0043200 | response to amino acid | 18497260 |
Tgene | MTOR | GO:0045727 | positive regulation of translation | 18762023 |
Tgene | MTOR | GO:0046777 | protein autophosphorylation | 15467718 |
Tgene | MTOR | GO:0071230 | cellular response to amino acid stimulus | 22424946 |
Tgene | MTOR | GO:0071233 | cellular response to leucine | 22424946 |
Tgene | MTOR | GO:1990253 | cellular response to leucine starvation | 22424946 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:16269559/chr1:11227574) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000375743 | ZBTB17 | chr1 | 16269559 | - | ENST00000361445 | MTOR | chr1 | 11227574 | - | 6408 | 2061 | 1909 | 5457 | 1182 |
ENST00000537142 | ZBTB17 | chr1 | 16269559 | - | ENST00000361445 | MTOR | chr1 | 11227574 | - | 6176 | 1829 | 1677 | 5225 | 1182 |
ENST00000375733 | ZBTB17 | chr1 | 16269559 | - | ENST00000361445 | MTOR | chr1 | 11227574 | - | 6414 | 2067 | 1915 | 5463 | 1182 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000375743 | ENST00000361445 | ZBTB17 | chr1 | 16269559 | - | MTOR | chr1 | 11227574 | - | 0.021417113 | 0.97858286 |
ENST00000537142 | ENST00000361445 | ZBTB17 | chr1 | 16269559 | - | MTOR | chr1 | 11227574 | - | 0.018918231 | 0.9810817 |
ENST00000375733 | ENST00000361445 | ZBTB17 | chr1 | 16269559 | - | MTOR | chr1 | 11227574 | - | 0.021381965 | 0.978618 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ZBTB17-MTOR |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ZBTB17 | chr1 | 16269559 | MTOR | chr1 | 11227574 | 1829 | 51 | RGGPVQAHHHSHCINNKLQQPEAAAG |
ZBTB17 | chr1 | 16269559 | MTOR | chr1 | 11227574 | 2061 | 51 | RGGPVQAHHHSHCINNKLQQPEAAAG |
ZBTB17 | chr1 | 16269559 | MTOR | chr1 | 11227574 | 2067 | 51 | RGGPVQAHHHSHCINNKLQQPEAAAG |
Top |
Potential FusionNeoAntigen Information of ZBTB17-MTOR in HLA I |
![]() |
ZBTB17-MTOR_16269559_11227574.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:01 | SHCINNKL | 0.9981 | 0.8952 | 10 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:01 | SHCINNKL | 0.9961 | 0.9424 | 10 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:02 | SHCINNKL | 0.9956 | 0.9504 | 10 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:01 | HHSHCINNKL | 0.9963 | 0.9026 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:01 | HHSHCINNKL | 0.987 | 0.9614 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:02 | HHSHCINNKL | 0.986 | 0.963 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B15:37 | HHSHCINNKL | 0.4779 | 0.594 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:01 | HHHSHCINNKL | 0.9991 | 0.9138 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:01 | HHHSHCINNKL | 0.9961 | 0.9713 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:02 | HHHSHCINNKL | 0.9958 | 0.9711 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B15:37 | HHHSHCINNKL | 0.7072 | 0.5234 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:05 | SHCINNKL | 0.9869 | 0.8714 | 10 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-C06:03 | QAHHHSHCI | 0.8493 | 0.9875 | 5 | 14 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:09 | HHSHCINNKL | 0.996 | 0.5224 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:05 | HHSHCINNKL | 0.9885 | 0.8841 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:09 | HHHSHCINNKL | 0.999 | 0.5233 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:12 | HHHSHCINNKL | 0.9987 | 0.9209 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:05 | HHHSHCINNKL | 0.9963 | 0.8988 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:05 | SHCINNKL | 0.9961 | 0.9424 | 10 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:11 | SHCINNKL | 0.7206 | 0.6659 | 10 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:31 | HHSHCINNKL | 0.9961 | 0.9033 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:05 | HHSHCINNKL | 0.987 | 0.9614 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:11 | HHSHCINNKL | 0.7257 | 0.8188 | 8 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:31 | HHHSHCINNKL | 0.9992 | 0.916 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B38:05 | HHHSHCINNKL | 0.9961 | 0.9713 | 7 | 18 |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 | HLA-B39:11 | HHHSHCINNKL | 0.8894 | 0.8631 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of ZBTB17-MTOR in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ZBTB17-MTOR |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
258 | AHHHSHCINNKLQQ | ZBTB17 | MTOR | chr1 | 16269559 | chr1 | 11227574 | 2067 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZBTB17-MTOR |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 258 | AHHHSHCINNKLQQ | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 258 | AHHHSHCINNKLQQ | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 258 | AHHHSHCINNKLQQ | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 258 | AHHHSHCINNKLQQ | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 258 | AHHHSHCINNKLQQ | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 258 | AHHHSHCINNKLQQ | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 258 | AHHHSHCINNKLQQ | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 258 | AHHHSHCINNKLQQ | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 258 | AHHHSHCINNKLQQ | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 258 | AHHHSHCINNKLQQ | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 258 | AHHHSHCINNKLQQ | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ZBTB17-MTOR |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 10 | 18 | SHCINNKL | TTCACACTGCATTAATAATAAGCT |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 5 | 14 | QAHHHSHCI | CCAAGCACATCATCATTCACACTGCAT |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 7 | 18 | HHHSHCINNKL | ACATCATCATTCACACTGCATTAATAATAAGCT |
ZBTB17-MTOR | chr1 | 16269559 | chr1 | 11227574 | 8 | 18 | HHSHCINNKL | TCATCATTCACACTGCATTAATAATAAGCT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ZBTB17-MTOR |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | ZBTB17-MTOR | chr1 | 16269559 | ENST00000375733 | chr1 | 11227574 | ENST00000361445 | TCGA-BR-4357-01A |
Top |
Potential target of CAR-T therapy development for ZBTB17-MTOR |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ZBTB17-MTOR |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ZBTB17-MTOR |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |