Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF234-DDX42

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF234-DDX42
	FusionPDB ID: 101669
	FusionGDB2.0 ID: 101669
		Hgene	Tgene
	Gene symbol	ZNF234	DDX42
	Gene ID	10780	11325
	Gene name	zinc finger protein 234	DEAD-box helicase 42
	Synonyms	HZF4\|ZNF269	DDX42P\|RHELP\|RNAHP\|SF3B8\|SF3b125
	Cytomap	19q13.31	17q23.3
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 234C2-H2 type zinc finger proteinHomo sapiens zinc finger 234zinc finger protein 234, partial sequencezinc finger protein 269zinc finger protein 4zinc finger protein HZF4	ATP-dependent RNA helicase DDX42DEAD (Asp-Glu-Ala-Asp) box helicase 42DEAD (Asp-Glu-Ala-Asp) box polypeptide 42SF3b DEAD box proteinsplicing factor 3B-associated 125 kDa proteinsplicing factor 3b, subunit 8
	Modification date	20200313	20200313
	UniProtAcc	.	Q86XP3 Main function of 5'-partner protein: FUNCTION: ATP-dependent RNA helicase. Binds to partially double-stranded RNAs (dsRNAs) in order to unwind RNA secondary structures. Unwinding is promoted in the presence of single-strand binding proteins. Mediates also RNA duplex formation thereby displacing the single-strand RNA binding protein. ATP and ADP modulate its activity: ATP binding and hydrolysis by DDX42 triggers RNA strand separation, whereas the ADP-bound form of the protein triggers annealing of complementary RNA strands. Involved in the survival of cells by interacting with TP53BP2 and thereby counteracting the apoptosis-stimulating activity of TP53BP2. Relocalizes TP53BP2 to the cytoplasm. {ECO:0000269\|PubMed:16397294, ECO:0000269\|PubMed:19377511}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000426739, ENST00000592437, ENST00000590748,	ENST00000582985, ENST00000359353, ENST00000389924, ENST00000457800, ENST00000578681, ENST00000583590,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 1 X 2=4	15 X 18 X 10=2700
	# samples	2	18
	** MAII score	log2(2/4*10)=2.32192809488736	log2(18/2700*10)=-3.90689059560852 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF234 [Title/Abstract] AND DDX42 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF234 [Title/Abstract] AND DDX42 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF234(44654658)-DDX42(61887872), # samples:1
Anticipated loss of major functional domain due to fusion event.	ZNF234-DDX42 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF234-DDX42 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF234-DDX42 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF234-DDX42 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	DDX42	GO:0008104	protein localization	19377511

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:44654658/chr17:61887872)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF234 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DDX42 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000592437	ZNF234	chr19	44654658	+	ENST00000578681	DDX42	chr17	61887872	+	2908	424	129	1988	619
ENST00000592437	ZNF234	chr19	44654658	+	ENST00000583590	DDX42	chr17	61887872	+	2908	424	129	1988	619
ENST00000592437	ZNF234	chr19	44654658	+	ENST00000359353	DDX42	chr17	61887872	+	1989	424	129	1988	619
ENST00000592437	ZNF234	chr19	44654658	+	ENST00000389924	DDX42	chr17	61887872	+	2907	424	129	1988	619
ENST00000592437	ZNF234	chr19	44654658	+	ENST00000457800	DDX42	chr17	61887872	+	2907	424	129	1988	619
ENST00000426739	ZNF234	chr19	44654658	+	ENST00000578681	DDX42	chr17	61887872	+	2977	493	198	2057	619
ENST00000426739	ZNF234	chr19	44654658	+	ENST00000583590	DDX42	chr17	61887872	+	2977	493	198	2057	619
ENST00000426739	ZNF234	chr19	44654658	+	ENST00000359353	DDX42	chr17	61887872	+	2058	493	198	2057	619
ENST00000426739	ZNF234	chr19	44654658	+	ENST00000389924	DDX42	chr17	61887872	+	2976	493	198	2057	619
ENST00000426739	ZNF234	chr19	44654658	+	ENST00000457800	DDX42	chr17	61887872	+	2976	493	198	2057	619

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000592437	ENST00000578681	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.000643765	0.9993562
ENST00000592437	ENST00000583590	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.000643765	0.9993562
ENST00000592437	ENST00000359353	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.002072869	0.99792707
ENST00000592437	ENST00000389924	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.000638931	0.9993611
ENST00000592437	ENST00000457800	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.000638931	0.9993611
ENST00000426739	ENST00000578681	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.00064132	0.9993587
ENST00000426739	ENST00000583590	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.00064132	0.9993587
ENST00000426739	ENST00000359353	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.00197957	0.9980204
ENST00000426739	ENST00000389924	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.000636154	0.99936384
ENST00000426739	ENST00000457800	ZNF234	chr19	44654658	+	DDX42	chr17	61887872	+	0.000636154	0.99936384

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF234-DDX42

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF234	chr19	44654658	DDX42	chr17	61887872	424	98	DIMKTATQRKGKSEYQVRSIASHVRP
ZNF234	chr19	44654658	DDX42	chr17	61887872	493	98	DIMKTATQRKGKSEYQVRSIASHVRP

Top

Potential FusionNeoAntigen Information of ZNF234-DDX42 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF234-DDX42_44654658_61887872.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:01	SEYQVRSI	0.9911	0.9144	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B41:01	SEYQVRSI	0.9906	0.6152	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B52:01	SEYQVRSI	0.9817	0.759	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:01	SEYQVRSI	0.9696	0.529	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B39:13	SEYQVRSI	0.8692	0.7501	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:01	TQRKGKSEY	0.9998	0.8815	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B45:01	SEYQVRSIA	0.9986	0.6745	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:25	TQRKGKSEY	0.9888	0.8913	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:02	TQRKGKSEY	0.9631	0.8937	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B41:01	SEYQVRSIA	0.7639	0.6574	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:01	SEYQVRSIA	0.7337	0.8851	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:03	TQRKGKSEY	0.6643	0.7387	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:18	TQRKGKSEY	0.5282	0.6526	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:01	SEYQVRSIA	0.3839	0.5535	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:01	ATQRKGKSEY	0.999	0.8703	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:25	ATQRKGKSEY	0.9925	0.8984	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B45:01	SEYQVRSIAS	0.9876	0.8082	12	22
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:03	ATQRKGKSEY	0.8331	0.7634	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:01	KSEYQVRSIA	0.6873	0.618	11	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:01	SEYQVRSIAS	0.6347	0.5536	12	22
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:01	TATQRKGKSEY	0.9987	0.8579	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:01	GKSEYQVRSIA	0.7955	0.749	10	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B51:07	SEYQVRSI	0.9756	0.5748	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:07	TQRKGKSEY	0.9983	0.6985	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:21	TQRKGKSEY	0.9656	0.8518	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:04	TQRKGKSEY	0.9591	0.9257	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-A31:01	KGKSEYQVR	0.8969	0.548	9	18
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:05	TQRKGKSEY	0.7928	0.858	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:31	TQRKGKSEY	0.7302	0.8613	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:07	ATQRKGKSEY	0.9982	0.6778	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:04	ATQRKGKSEY	0.9493	0.92	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B40:06	KSEYQVRSIA	0.9288	0.5615	11	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:07	TATQRKGKSEY	0.9987	0.6769	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B40:06	GKSEYQVRSIA	0.9161	0.619	10	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B40:04	SEYQVRSI	0.9996	0.6514	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:11	SEYQVRSI	0.9932	0.8512	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:05	SEYQVRSI	0.9911	0.9144	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:08	SEYQVRSI	0.991	0.8629	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:06	SEYQVRSI	0.9909	0.9289	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:03	SEYQVRSI	0.9903	0.9107	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:05	SEYQVRSI	0.9696	0.529	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:04	SEYQVRSI	0.9696	0.529	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B39:02	SEYQVRSI	0.9231	0.7595	12	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:33	TQRKGKSEY	0.9998	0.8815	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:27	TQRKGKSEY	0.9998	0.9026	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:125	TQRKGKSEY	0.9998	0.8815	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:34	TQRKGKSEY	0.9998	0.8815	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:135	TQRKGKSEY	0.9998	0.8996	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:50	TQRKGKSEY	0.9996	0.8731	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:11	TQRKGKSEY	0.9995	0.7973	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:08	TQRKGKSEY	0.9995	0.807	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B35:43	TQRKGKSEY	0.9994	0.8111	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:24	TQRKGKSEY	0.999	0.8778	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:12	TQRKGKSEY	0.9984	0.9015	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:35	TQRKGKSEY	0.9983	0.8815	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-C15:05	KSEYQVRSI	0.9982	0.8345	11	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-C15:02	KSEYQVRSI	0.9977	0.7667	11	20
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:53	TQRKGKSEY	0.9957	0.8637	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B40:04	SEYQVRSIA	0.9907	0.6974	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:39	TQRKGKSEY	0.9902	0.8013	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:54	TQRKGKSEY	0.9493	0.8368	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:20	TQRKGKSEY	0.7762	0.9108	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:68	TQRKGKSEY	0.7686	0.6316	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:05	SEYQVRSIA	0.7337	0.8851	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:06	SEYQVRSIA	0.7077	0.9041	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B35:28	TQRKGKSEY	0.6997	0.9173	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:03	SEYQVRSIA	0.6988	0.8812	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B35:20	TQRKGKSEY	0.6704	0.9178	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:04	TQRKGKSEY	0.6357	0.9034	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B18:11	SEYQVRSIA	0.5999	0.8432	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:73	TQRKGKSEY	0.5824	0.7493	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-C12:02	TQRKGKSEY	0.3843	0.9471	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:04	SEYQVRSIA	0.3839	0.5535	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:05	SEYQVRSIA	0.3839	0.5535	12	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-C02:02	TQRKGKSEY	0.3011	0.9611	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-C02:10	TQRKGKSEY	0.3011	0.9611	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B48:02	TQRKGKSEY	0.2685	0.9074	6	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:33	ATQRKGKSEY	0.999	0.8703	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:125	ATQRKGKSEY	0.999	0.8703	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:27	ATQRKGKSEY	0.999	0.8812	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:34	ATQRKGKSEY	0.999	0.8703	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:135	ATQRKGKSEY	0.9988	0.8963	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:35	ATQRKGKSEY	0.9979	0.8629	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:50	ATQRKGKSEY	0.9976	0.8903	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:12	ATQRKGKSEY	0.9966	0.9098	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:53	ATQRKGKSEY	0.9952	0.8483	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:39	ATQRKGKSEY	0.9927	0.8221	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:54	ATQRKGKSEY	0.9429	0.8244	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:68	ATQRKGKSEY	0.93	0.6065	5	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:04	KSEYQVRSIA	0.6873	0.618	11	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:05	KSEYQVRSIA	0.6873	0.618	11	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:04	SEYQVRSIAS	0.6347	0.5536	12	22
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:05	SEYQVRSIAS	0.6347	0.5536	12	22
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:125	TATQRKGKSEY	0.9987	0.8579	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:33	TATQRKGKSEY	0.9987	0.8579	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:34	TATQRKGKSEY	0.9987	0.8579	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:27	TATQRKGKSEY	0.9987	0.8689	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:135	TATQRKGKSEY	0.9985	0.8928	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:35	TATQRKGKSEY	0.9982	0.8547	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:50	TATQRKGKSEY	0.998	0.8602	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:12	TATQRKGKSEY	0.9979	0.8757	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:53	TATQRKGKSEY	0.9956	0.8361	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:68	TATQRKGKSEY	0.9934	0.6034	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B15:54	TATQRKGKSEY	0.9898	0.8085	4	15
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:04	GKSEYQVRSIA	0.7955	0.749	10	21
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	HLA-B50:05	GKSEYQVRSIA	0.7955	0.749	10	21

Top

Potential FusionNeoAntigen Information of ZNF234-DDX42 in HLA II

ZNF234-DDX42_44654658_61887872.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB1-0815	KSEYQVRSIASHVRP	11	26
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB1-0830	KSEYQVRSIASHVRP	11	26
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB5-0106	KSEYQVRSIASHVRP	11	26
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB5-0111	KSEYQVRSIASHVRP	11	26
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB5-0202	KSEYQVRSIASHVRP	11	26
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB5-0203	KSEYQVRSIASHVRP	11	26
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB5-0204	KSEYQVRSIASHVRP	11	26
ZNF234-DDX42	chr19	44654658	chr17	61887872	493	DRB5-0205	KSEYQVRSIASHVRP	11	26

Top

Fusion breakpoint peptide structures of ZNF234-DDX42

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9585	TQRKGKSEYQVRSI	ZNF234	DDX42	chr19	44654658	chr17	61887872	493

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF234-DDX42

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9585	TQRKGKSEYQVRSI	-7.15543	-7.26883
HLA-B14:02	3BVN	9585	TQRKGKSEYQVRSI	-4.77435	-5.80965
HLA-B52:01	3W39	9585	TQRKGKSEYQVRSI	-6.80875	-6.92215
HLA-B52:01	3W39	9585	TQRKGKSEYQVRSI	-4.20386	-5.23916
HLA-A11:01	4UQ2	9585	TQRKGKSEYQVRSI	-7.5194	-8.5547
HLA-A11:01	4UQ2	9585	TQRKGKSEYQVRSI	-6.9601	-7.0735
HLA-A24:02	5HGA	9585	TQRKGKSEYQVRSI	-7.52403	-7.63743
HLA-A24:02	5HGA	9585	TQRKGKSEYQVRSI	-5.82433	-6.85963
HLA-B27:05	6PYJ	9585	TQRKGKSEYQVRSI	-3.28285	-4.31815
HLA-B44:05	3DX8	9585	TQRKGKSEYQVRSI	-5.91172	-6.94702
HLA-B44:05	3DX8	9585	TQRKGKSEYQVRSI	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ZNF234-DDX42

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF234-DDX42	chr19	44654658	chr17	61887872	10	21	GKSEYQVRSIA	GGAAATCAGAGTACCAAGTTCGATCCATAGCAA
ZNF234-DDX42	chr19	44654658	chr17	61887872	11	20	KSEYQVRSI	AATCAGAGTACCAAGTTCGATCCATAG
ZNF234-DDX42	chr19	44654658	chr17	61887872	11	21	KSEYQVRSIA	AATCAGAGTACCAAGTTCGATCCATAGCAA
ZNF234-DDX42	chr19	44654658	chr17	61887872	12	20	SEYQVRSI	CAGAGTACCAAGTTCGATCCATAG
ZNF234-DDX42	chr19	44654658	chr17	61887872	12	21	SEYQVRSIA	CAGAGTACCAAGTTCGATCCATAGCAA
ZNF234-DDX42	chr19	44654658	chr17	61887872	12	22	SEYQVRSIAS	CAGAGTACCAAGTTCGATCCATAGCAAGTC
ZNF234-DDX42	chr19	44654658	chr17	61887872	4	15	TATQRKGKSEY	CAGCAACTCAAAGAAAAGGGAAATCAGAGTACC
ZNF234-DDX42	chr19	44654658	chr17	61887872	5	15	ATQRKGKSEY	CAACTCAAAGAAAAGGGAAATCAGAGTACC
ZNF234-DDX42	chr19	44654658	chr17	61887872	6	15	TQRKGKSEY	CTCAAAGAAAAGGGAAATCAGAGTACC
ZNF234-DDX42	chr19	44654658	chr17	61887872	9	18	KGKSEYQVR	AAGGGAAATCAGAGTACCAAGTTCGAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ZNF234-DDX42	chr19	44654658	chr17	61887872	11	26	KSEYQVRSIASHVRP	AATCAGAGTACCAAGTTCGATCCATAGCAAGTCATGTTCGTCCTG

Top

Information of the samples that have these potential fusion neoantigens of ZNF234-DDX42

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	ZNF234-DDX42	chr19	44654658	ENST00000426739	chr17	61887872	ENST00000359353	TCGA-L5-A8NF

Top

Potential target of CAR-T therapy development for ZNF234-DDX42

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF234-DDX42

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF234-DDX42

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)