Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF292-MAP3K4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF292-MAP3K4
	FusionPDB ID: 101824
	FusionGDB2.0 ID: 101824
		Hgene	Tgene
	Gene symbol	ZNF292	MAP3K4
	Gene ID	23036	4216
	Gene name	zinc finger protein 292	mitogen-activated protein kinase kinase kinase 4
	Synonyms	Nbla00365\|ZFP292\|ZN-16\|Zn-15\|bA393I2.3	MAPKKK4\|MEKK 4\|MEKK4\|MTK1\|PRO0412
	Cytomap	6q14.3	6q26
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 29216 zinc-finger domain proteinputative protein product of Nbla00365	mitogen-activated protein kinase kinase kinase 4MAP three kinase 1MAP/ERK kinase kinase 4MAPK/ERK kinase kinase 4MEK kinase 4SSK2/SSK22 MAP kinase kinase kinase, yeast, homolog ofdJ473J16.1 (mitogen-activated protein kinase kinase kinase 4)predicte
	Modification date	20200313	20200313
	UniProtAcc	.	Q9Y6R4 Main function of 5'-partner protein: FUNCTION: Component of a protein kinase signal transduction cascade. Activates the CSBP2, P38 and JNK MAPK pathways, but not the ERK pathway. Specifically phosphorylates and activates MAP2K4 and MAP2K6. {ECO:0000269\|PubMed:12052864, ECO:0000269\|PubMed:9305639}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000369578, ENST00000339907, ENST00000369577, ENST00000392985,	ENST00000348824, ENST00000366919, ENST00000366920, ENST00000392142, ENST00000446500,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	24 X 7 X 12=2016	5 X 5 X 2=50
	# samples	27	5
	** MAII score	log2(27/2016*10)=-2.90046432644909 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/50*10)=0
Fusion gene context	PubMed: ZNF292 [Title/Abstract] AND MAP3K4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF292 [Title/Abstract] AND MAP3K4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF292(87865477)-MAP3K4(161491640), # samples:2
Anticipated loss of major functional domain due to fusion event.	ZNF292-MAP3K4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF292-MAP3K4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF292-MAP3K4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF292-MAP3K4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MAP3K4	GO:0000186	activation of MAPKK activity	9305639\|9827804
Tgene	MAP3K4	GO:0043507	positive regulation of JUN kinase activity	9305639
Tgene	MAP3K4	GO:1900745	positive regulation of p38MAPK cascade	9305639

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:87865477/chr6:161491640)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF292 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MAP3K4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000369577	ZNF292	chr6	87865477	+	ENST00000366919	MAP3K4	chr6	161491640	+	3696	211	43	3180	1045
ENST00000369577	ZNF292	chr6	87865477	+	ENST00000392142	MAP3K4	chr6	161491640	+	3846	211	43	3330	1095
ENST00000369577	ZNF292	chr6	87865477	+	ENST00000348824	MAP3K4	chr6	161491640	+	3681	211	43	3168	1041
ENST00000369577	ZNF292	chr6	87865477	+	ENST00000366920	MAP3K4	chr6	161491640	+	3831	211	43	3318	1091
ENST00000339907	ZNF292	chr6	87865477	+	ENST00000366919	MAP3K4	chr6	161491640	+	3664	179	11	3148	1045
ENST00000339907	ZNF292	chr6	87865477	+	ENST00000392142	MAP3K4	chr6	161491640	+	3814	179	11	3298	1095
ENST00000339907	ZNF292	chr6	87865477	+	ENST00000348824	MAP3K4	chr6	161491640	+	3649	179	11	3136	1041
ENST00000339907	ZNF292	chr6	87865477	+	ENST00000366920	MAP3K4	chr6	161491640	+	3799	179	11	3286	1091
ENST00000392985	ZNF292	chr6	87865477	+	ENST00000366919	MAP3K4	chr6	161491640	+	3890	405	237	3374	1045
ENST00000392985	ZNF292	chr6	87865477	+	ENST00000392142	MAP3K4	chr6	161491640	+	4040	405	237	3524	1095
ENST00000392985	ZNF292	chr6	87865477	+	ENST00000348824	MAP3K4	chr6	161491640	+	3875	405	237	3362	1041
ENST00000392985	ZNF292	chr6	87865477	+	ENST00000366920	MAP3K4	chr6	161491640	+	4025	405	237	3512	1091

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000369577	ENST00000366919	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.000963892	0.9990361
ENST00000369577	ENST00000392142	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.000872621	0.99912745
ENST00000369577	ENST00000348824	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.001112009	0.99888796
ENST00000369577	ENST00000366920	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.000743745	0.9992562
ENST00000339907	ENST00000366919	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.000987698	0.99901223
ENST00000339907	ENST00000392142	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.000893105	0.9991068
ENST00000339907	ENST00000348824	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.001141641	0.99885833
ENST00000339907	ENST00000366920	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.000760394	0.9992397
ENST00000392985	ENST00000366919	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.001216985	0.99878305
ENST00000392985	ENST00000392142	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.001100824	0.9988991
ENST00000392985	ENST00000348824	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.001406287	0.99859375
ENST00000392985	ENST00000366920	ZNF292	chr6	87865477	+	MAP3K4	chr6	161491640	+	0.000940705	0.99905926

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF292-MAP3K4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF292	chr6	87865477	MAP3K4	chr6	161491640	179	56	VEAATDYCQQLCQFSEFPDPMWGSDY
ZNF292	chr6	87865477	MAP3K4	chr6	161491640	211	56	VEAATDYCQQLCQFSEFPDPMWGSDY
ZNF292	chr6	87865477	MAP3K4	chr6	161491640	405	56	VEAATDYCQQLCQFSEFPDPMWGSDY

Top

Potential FusionNeoAntigen Information of ZNF292-MAP3K4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF292-MAP3K4_87865477_161491640.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:01	QQLCQFSEF	0.9991	0.7906	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:25	QQLCQFSEF	0.9784	0.9043	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:03	QQLCQFSEF	0.9225	0.7895	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B13:01	QQLCQFSEF	0.7755	0.9658	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-A24:17	QFSEFPDPMW	0.9671	0.5197	12	22
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B58:01	QFSEFPDPMW	0.9222	0.9929	12	22
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:07	QQLCQFSEF	0.9962	0.5638	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:05	QQLCQFSEF	0.9637	0.9428	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:125	QQLCQFSEF	0.9991	0.7906	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:135	QQLCQFSEF	0.9991	0.7966	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:34	QQLCQFSEF	0.9991	0.7906	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:33	QQLCQFSEF	0.9991	0.7906	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:27	QQLCQFSEF	0.9991	0.8173	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:50	QQLCQFSEF	0.9986	0.8685	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:24	QQLCQFSEF	0.9986	0.802	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:35	QQLCQFSEF	0.9961	0.7442	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:12	QQLCQFSEF	0.9949	0.8089	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:53	QQLCQFSEF	0.9938	0.7644	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:39	QQLCQFSEF	0.98	0.8248	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:20	QQLCQFSEF	0.9615	0.9673	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B35:28	QQLCQFSEF	0.9543	0.9709	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:68	QQLCQFSEF	0.9499	0.5199	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:54	QQLCQFSEF	0.9448	0.7437	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B48:02	QQLCQFSEF	0.8914	0.968	8	17
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-C14:02	QFSEFPDPM	0.5558	0.9713	12	21
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-C14:03	QFSEFPDPM	0.5558	0.9713	12	21
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B57:04	QFSEFPDPMW	0.9841	0.9147	12	22
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B57:02	QFSEFPDPMW	0.8843	0.9709	12	22
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	179	HLA-B15:24	CQFSEFPDPMW	0.9996	0.9512	11	22

Top

Potential FusionNeoAntigen Information of ZNF292-MAP3K4 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ZNF292-MAP3K4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10596	YCQQLCQFSEFPDP	ZNF292	MAP3K4	chr6	87865477	chr6	161491640	179

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF292-MAP3K4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10596	YCQQLCQFSEFPDP	-6.12283	-6.12283
HLA-A24:02	5HGA	10596	YCQQLCQFSEFPDP	-7.36995	-7.36995

Top

Vaccine Design for the FusionNeoAntigens of ZNF292-MAP3K4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	11	22	CQFSEFPDPMW	TGCCAGTTTTCTGAATTTCCAGATCCCATGTGG
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	12	21	QFSEFPDPM	CAGTTTTCTGAATTTCCAGATCCCATG
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	12	22	QFSEFPDPMW	CAGTTTTCTGAATTTCCAGATCCCATGTGG
ZNF292-MAP3K4	chr6	87865477	chr6	161491640	8	17	QQLCQFSEF	CAGCAGCTGTGCCAGTTTTCTGAATTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ZNF292-MAP3K4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	ZNF292-MAP3K4	chr6	87865477	ENST00000339907	chr6	161491640	ENST00000348824	TCGA-DX-A3M1-01A

Top

Potential target of CAR-T therapy development for ZNF292-MAP3K4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF292-MAP3K4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF292-MAP3K4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)