Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF331-WDR37

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF331-WDR37
	FusionPDB ID: 101886
	FusionGDB2.0 ID: 101886
		Hgene	Tgene
	Gene symbol	ZNF331	WDR37
	Gene ID	55422	22884
	Gene name	zinc finger protein 331	WD repeat domain 37
	Synonyms	RITA\|ZNF361\|ZNF463	NOCGUS
	Cytomap	19q13.42	10p15.3
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 331C2H2-like zinc finger protein rearranged in thyroid adenomasKRAB zinc finger proteinzinc finger protein 361zinc finger protein 463	WD repeat-containing protein 37
	Modification date	20200313	20200322
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000253144, ENST00000411977, ENST00000449416, ENST00000511154, ENST00000511593, ENST00000512387, ENST00000513265, ENST00000513999, ENST00000513929,	ENST00000482165, ENST00000263150, ENST00000358220, ENST00000381329,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 6 X 4=168	8 X 6 X 5=240
	# samples	7	8
	** MAII score	log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/240*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF331 [Title/Abstract] AND WDR37 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF331 [Title/Abstract] AND WDR37 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF331(54074984)-WDR37(1125950), # samples:1
Anticipated loss of major functional domain due to fusion event.	ZNF331-WDR37 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF331-WDR37 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:54074984/chr10:1125950)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF331 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across WDR37 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000253144	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	5672	1469	1333	2718	461
ENST00000253144	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	2340	1469	1333	1983	216
ENST00000253144	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	5545	1469	1333	2718	461
ENST00000511593	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	4803	600	464	1849	461
ENST00000511593	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	1471	600	464	1114	216
ENST00000511593	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	4676	600	464	1849	461
ENST00000449416	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	4447	244	108	1493	461
ENST00000449416	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	1115	244	108	758	216
ENST00000449416	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	4320	244	108	1493	461
ENST00000411977	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	4761	558	422	1807	461
ENST00000411977	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	1429	558	422	1072	216
ENST00000411977	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	4634	558	422	1807	461
ENST00000511154	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	4633	430	294	1679	461
ENST00000511154	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	1301	430	294	944	216
ENST00000511154	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	4506	430	294	1679	461
ENST00000513999	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	4708	505	369	1754	461
ENST00000513999	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	1376	505	369	1019	216
ENST00000513999	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	4581	505	369	1754	461
ENST00000512387	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	4640	437	301	1686	461
ENST00000512387	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	1308	437	301	951	216
ENST00000512387	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	4513	437	301	1686	461
ENST00000513265	ZNF331	chr19	54074984	+	ENST00000358220	WDR37	chr10	1125950	+	4538	335	199	1584	461
ENST00000513265	ZNF331	chr19	54074984	+	ENST00000381329	WDR37	chr10	1125950	+	1206	335	199	849	216
ENST00000513265	ZNF331	chr19	54074984	+	ENST00000263150	WDR37	chr10	1125950	+	4411	335	199	1584	461

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000253144	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001089783	0.9989102
ENST00000253144	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.005392395	0.99460757
ENST00000253144	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001144917	0.9988551
ENST00000511593	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.00120339	0.9987966
ENST00000511593	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.008325418	0.9916746
ENST00000511593	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001280119	0.99871993
ENST00000449416	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001084684	0.9989153
ENST00000449416	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.008579733	0.99142027
ENST00000449416	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001157092	0.99884284
ENST00000411977	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001334381	0.9986656
ENST00000411977	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.008670427	0.99132955
ENST00000411977	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001415309	0.99858475
ENST00000511154	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001258596	0.99874145
ENST00000511154	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.008773578	0.9912264
ENST00000511154	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001334541	0.99866545
ENST00000513999	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.00133223	0.99866784
ENST00000513999	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.010044105	0.9899559
ENST00000513999	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001420463	0.9985795
ENST00000512387	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.0012658	0.9987342
ENST00000512387	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.007400877	0.9925991
ENST00000512387	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001340261	0.99865973
ENST00000513265	ENST00000358220	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001239078	0.99876094
ENST00000513265	ENST00000381329	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.00876147	0.99123853
ENST00000513265	ENST00000263150	ZNF331	chr19	54074984	+	WDR37	chr10	1125950	+	0.001315773	0.9986842

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF331-WDR37

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF331	chr19	54074984	WDR37	chr10	1125950	1469	45	DVMLENYSNLVSLVRREIDTLNERLA
ZNF331	chr19	54074984	WDR37	chr10	1125950	244	45	DVMLENYSNLVSLVRREIDTLNERLA
ZNF331	chr19	54074984	WDR37	chr10	1125950	335	45	DVMLENYSNLVSLVRREIDTLNERLA
ZNF331	chr19	54074984	WDR37	chr10	1125950	430	45	DVMLENYSNLVSLVRREIDTLNERLA
ZNF331	chr19	54074984	WDR37	chr10	1125950	437	45	DVMLENYSNLVSLVRREIDTLNERLA
ZNF331	chr19	54074984	WDR37	chr10	1125950	505	45	DVMLENYSNLVSLVRREIDTLNERLA
ZNF331	chr19	54074984	WDR37	chr10	1125950	558	45	DVMLENYSNLVSLVRREIDTLNERLA
ZNF331	chr19	54074984	WDR37	chr10	1125950	600	45	DVMLENYSNLVSLVRREIDTLNERLA

Top

Potential FusionNeoAntigen Information of ZNF331-WDR37 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF331-WDR37_54074984_1125950.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	HLA-B15:73	LVRREIDTL	0.7838	0.7822	12	21
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	HLA-B15:30	LVRREIDTL	0.6775	0.8374	12	21
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	HLA-C06:02	NYSNLVSLV	0.0749	0.9809	5	14
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	HLA-C06:17	NYSNLVSLV	0.0749	0.9809	5	14
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	HLA-C06:06	NYSNLVSLV	0.0165	0.9634	5	14

Top

Potential FusionNeoAntigen Information of ZNF331-WDR37 in HLA II

ZNF331-WDR37_54074984_1125950.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-0812	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1172	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1189	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1192	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1192	YSNLVSLVRREIDTL	6	21
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1192	ENYSNLVSLVRREID	4	19
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1204	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1209	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1354	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1358	SNLVSLVRREIDTLN	7	22
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1358	YSNLVSLVRREIDTL	6	21
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1358	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1377	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1377	YSNLVSLVRREIDTL	6	21
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1381	SNLVSLVRREIDTLN	7	22
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1381	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1381	YSNLVSLVRREIDTL	6	21
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1389	SNLVSLVRREIDTLN	7	22
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1401	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1404	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1426	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1428	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1431	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1432	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1435	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1454	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1455	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1458	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1460	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1461	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1462	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1464	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1465	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1465	YSNLVSLVRREIDTL	6	21
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1470	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1472	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1473	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1478	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1486	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1487	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1488	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1490	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1497	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1499	NYSNLVSLVRREIDT	5	20
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB1-1537	DVMLENYSNLVSLVR	0	15
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0101	MLENYSNLVSLVRRE	2	17
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0101	LENYSNLVSLVRREI	3	18
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0102	MLENYSNLVSLVRRE	2	17
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0102	LENYSNLVSLVRREI	3	18
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0104	MLENYSNLVSLVRRE	2	17
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0105	MLENYSNLVSLVRRE	2	17
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0105	LENYSNLVSLVRREI	3	18
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0108N	MLENYSNLVSLVRRE	2	17
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0108N	LENYSNLVSLVRREI	3	18
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0113	MLENYSNLVSLVRRE	2	17
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0113	LENYSNLVSLVRREI	3	18
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0114	MLENYSNLVSLVRRE	2	17
ZNF331-WDR37	chr19	54074984	chr10	1125950	1469	DRB5-0114	LENYSNLVSLVRREI	3	18

Top

Fusion breakpoint peptide structures of ZNF331-WDR37

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10813	YSNLVSLVRREIDT	ZNF331	WDR37	chr19	54074984	chr10	1125950	1469

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF331-WDR37

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10813	YSNLVSLVRREIDT	-7.9962	-8.1096
HLA-B14:02	3BVN	10813	YSNLVSLVRREIDT	-5.70842	-6.74372
HLA-B52:01	3W39	10813	YSNLVSLVRREIDT	-6.83737	-6.95077
HLA-B52:01	3W39	10813	YSNLVSLVRREIDT	-4.4836	-5.5189
HLA-A11:01	4UQ2	10813	YSNLVSLVRREIDT	-10.0067	-10.1201
HLA-A11:01	4UQ2	10813	YSNLVSLVRREIDT	-9.03915	-10.0745
HLA-A24:02	5HGA	10813	YSNLVSLVRREIDT	-6.56204	-6.67544
HLA-A24:02	5HGA	10813	YSNLVSLVRREIDT	-5.42271	-6.45801
HLA-B44:05	3DX8	10813	YSNLVSLVRREIDT	-7.85648	-8.89178
HLA-B44:05	3DX8	10813	YSNLVSLVRREIDT	-5.3978	-5.5112
HLA-A02:01	6TDR	10813	YSNLVSLVRREIDT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ZNF331-WDR37

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF331-WDR37	chr19	54074984	chr10	1125950	12	21	LVRREIDTL	TGGTACGTAGAGAAATCGACACTCTTA
ZNF331-WDR37	chr19	54074984	chr10	1125950	5	14	NYSNLVSLV	ACTACAGTAACTTGGTCTCACTGGTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ZNF331-WDR37	chr19	54074984	chr10	1125950	0	15	DVMLENYSNLVSLVR	ACGTGATGCTGGAGAACTACAGTAACTTGGTCTCACTGGTACGTA
ZNF331-WDR37	chr19	54074984	chr10	1125950	2	17	MLENYSNLVSLVRRE	TGCTGGAGAACTACAGTAACTTGGTCTCACTGGTACGTAGAGAAA
ZNF331-WDR37	chr19	54074984	chr10	1125950	3	18	LENYSNLVSLVRREI	TGGAGAACTACAGTAACTTGGTCTCACTGGTACGTAGAGAAATCG
ZNF331-WDR37	chr19	54074984	chr10	1125950	4	19	ENYSNLVSLVRREID	AGAACTACAGTAACTTGGTCTCACTGGTACGTAGAGAAATCGACA
ZNF331-WDR37	chr19	54074984	chr10	1125950	5	20	NYSNLVSLVRREIDT	ACTACAGTAACTTGGTCTCACTGGTACGTAGAGAAATCGACACTC
ZNF331-WDR37	chr19	54074984	chr10	1125950	6	21	YSNLVSLVRREIDTL	ACAGTAACTTGGTCTCACTGGTACGTAGAGAAATCGACACTCTTA
ZNF331-WDR37	chr19	54074984	chr10	1125950	7	22	SNLVSLVRREIDTLN	GTAACTTGGTCTCACTGGTACGTAGAGAAATCGACACTCTTAATG

Top

Information of the samples that have these potential fusion neoantigens of ZNF331-WDR37

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	ZNF331-WDR37	chr19	54074984	ENST00000253144	chr10	1125950	ENST00000263150	DB086777

Top

Potential target of CAR-T therapy development for ZNF331-WDR37

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF331-WDR37

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF331-WDR37

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)