Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF430-KCNIP4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF430-KCNIP4
	FusionPDB ID: 102082
	FusionGDB2.0 ID: 102082
		Hgene	Tgene
	Gene symbol	ZNF430	KCNIP4
	Gene ID	80264	80333
	Gene name	zinc finger protein 430	potassium voltage-gated channel interacting protein 4
	Synonyms	-	CALP\|KCHIP4
	Cytomap	19p12	4p15.31-p15.2
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 430	Kv channel-interacting protein 4Kv channel interacting protein 4a-type potassium channel modulatory protein 4calsenilin-like protein
	Modification date	20200313	20200313
	UniProtAcc	.	Q6PIL6 Main function of 5'-partner protein: FUNCTION: Regulatory subunit of Kv4/D (Shal)-type voltage-gated rapidly inactivating A-type potassium channels. Modulates KCND2 channel density, inactivation kinetics and rate of recovery from inactivation in a calcium-dependent and isoform-specific manner (PubMed:11847232, PubMed:18957440, PubMed:23576435). Modulates KCND3/Kv4.3 currents (PubMed:23576435). Isoform 4 does not increase KCND2 expression at the cell membrane (PubMed:18957440). Isoform 4 retains KCND3 in the endoplasmic reticulum and negatively regulates its expression at the cell membrane. {ECO:0000250\|UniProtKB:Q6PHZ8, ECO:0000269\|PubMed:11847232, ECO:0000269\|PubMed:18957440, ECO:0000269\|PubMed:23576435}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000261560, ENST00000595401, ENST00000599548,	ENST00000359001, ENST00000382149, ENST00000509207, ENST00000382148, ENST00000382150, ENST00000382152, ENST00000447367,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 2 X 5=60	18 X 13 X 9=2106
	# samples	6	19
	** MAII score	log2(6/60*10)=0	log2(19/2106*10)=-3.47043411269477 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF430 [Title/Abstract] AND KCNIP4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF430 [Title/Abstract] AND KCNIP4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF430(21216990)-KCNIP4(20852290), # samples:2
Anticipated loss of major functional domain due to fusion event.	ZNF430-KCNIP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF430-KCNIP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF430-KCNIP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF430-KCNIP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF430-KCNIP4 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. ZNF430-KCNIP4 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:21216990/chr4:20852290)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF430 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across KCNIP4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000261560	ZNF430	chr19	21216990	+	ENST00000382148	KCNIP4	chr4	20852290	-	2559	503	181	1092	303
ENST00000261560	ZNF430	chr19	21216990	+	ENST00000447367	KCNIP4	chr4	20852290	-	1969	503	181	1092	303
ENST00000261560	ZNF430	chr19	21216990	+	ENST00000382150	KCNIP4	chr4	20852290	-	1965	503	181	1092	303
ENST00000261560	ZNF430	chr19	21216990	+	ENST00000382152	KCNIP4	chr4	20852290	-	1939	503	181	1092	303
ENST00000599548	ZNF430	chr19	21216990	+	ENST00000382148	KCNIP4	chr4	20852290	-	2545	489	167	1078	303
ENST00000599548	ZNF430	chr19	21216990	+	ENST00000447367	KCNIP4	chr4	20852290	-	1955	489	167	1078	303
ENST00000599548	ZNF430	chr19	21216990	+	ENST00000382150	KCNIP4	chr4	20852290	-	1951	489	167	1078	303
ENST00000599548	ZNF430	chr19	21216990	+	ENST00000382152	KCNIP4	chr4	20852290	-	1925	489	167	1078	303

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000261560	ENST00000382148	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.000589442	0.9994105
ENST00000261560	ENST00000447367	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.000541738	0.99945825
ENST00000261560	ENST00000382150	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.000538444	0.9994616
ENST00000261560	ENST00000382152	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.00054114	0.99945885
ENST00000599548	ENST00000382148	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.000628408	0.9993716
ENST00000599548	ENST00000447367	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.000573523	0.9994265
ENST00000599548	ENST00000382150	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.000564314	0.9994357
ENST00000599548	ENST00000382152	ZNF430	chr19	21216990	+	KCNIP4	chr4	20852290	-	0.000570446	0.9994295

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF430-KCNIP4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF430	chr19	21216990	KCNIP4	chr4	20852290	489	107	WNMKRHAMVDQPPDSVEDELEMATVR
ZNF430	chr19	21216990	KCNIP4	chr4	20852290	503	107	WNMKRHAMVDQPPDSVEDELEMATVR

Top

Potential FusionNeoAntigen Information of ZNF430-KCNIP4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF430-KCNIP4_21216990_20852290.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:20	MVDQPPDSV	0.9545	0.6864	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:21	MVDQPPDSV	0.9442	0.78	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:60	MVDQPPDSV	0.9362	0.6915	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:35	MVDQPPDSV	0.9279	0.6797	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:38	MVDQPPDSV	0.925	0.8188	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:27	MVDQPPDSV	0.7696	0.7431	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:13	MVDQPPDSV	0.7161	0.8204	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:19	MVDQPPDSV	0.4868	0.6469	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:22	AMVDQPPDSV	0.9965	0.6057	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:27	AMVDQPPDSV	0.9955	0.7258	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:24	AMVDQPPDSV	0.9947	0.6386	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:67	AMVDQPPDSV	0.9947	0.6386	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:30	AMVDQPPDSV	0.9947	0.6386	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:60	AMVDQPPDSV	0.9945	0.6574	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:11	AMVDQPPDSV	0.9942	0.6466	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:13	AMVDQPPDSV	0.9936	0.8152	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:21	AMVDQPPDSV	0.9933	0.7389	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:04	AMVDQPPDSV	0.9848	0.8259	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:38	AMVDQPPDSV	0.9777	0.8259	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:19	AMVDQPPDSV	0.9735	0.6074	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:29	AMVDQPPDSV	0.9438	0.6393	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:35	AMVDQPPDSV	0.9292	0.6429	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:20	AMVDQPPDSV	0.9181	0.6496	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-B35:03	QPPDSVEDEL	0.6503	0.9617	10	20
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-B35:02	QPPDSVEDEL	0.4156	0.9866	10	20
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-B35:04	QPPDSVEDEL	0.4156	0.9866	10	20
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C05:09	MVDQPPDSV	0.9999	0.9826	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C04:10	MVDQPPDSV	0.9998	0.9754	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C04:07	MVDQPPDSV	0.9997	0.98	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C08:15	MVDQPPDSV	0.9996	0.9872	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C04:06	MVDQPPDSV	0.9948	0.9716	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C08:04	MVDQPPDSV	0.9458	0.9849	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C08:13	MVDQPPDSV	0.9458	0.9849	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C04:14	MVDQPPDSV	0.9427	0.9817	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:07	MVDQPPDSV	0.9328	0.7264	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:05	MVDQPPDSV	0.8978	0.6835	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C08:03	MVDQPPDSV	0.8751	0.992	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:05	AMVDQPPDSV	0.9948	0.5769	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:01	AMVDQPPDSV	0.9947	0.6386	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-B39:10	QPPDSVEDEL	0.507	0.9536	10	20
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-B35:12	QPPDSVEDEL	0.4156	0.9866	10	20
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C04:03	MVDQPPDSV	0.9999	0.9815	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C05:01	MVDQPPDSV	0.9999	0.9826	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C18:01	MVDQPPDSV	0.9998	0.9805	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C04:01	MVDQPPDSV	0.9997	0.98	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C01:03	MVDQPPDSV	0.9997	0.9763	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C08:02	MVDQPPDSV	0.9996	0.9872	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C04:04	MVDQPPDSV	0.9828	0.9686	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A68:02	MVDQPPDSV	0.9753	0.841	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C03:06	MVDQPPDSV	0.9668	0.9918	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A69:01	MVDQPPDSV	0.955	0.8293	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:06	MVDQPPDSV	0.9442	0.78	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:14	MVDQPPDSV	0.9435	0.7537	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C17:01	MVDQPPDSV	0.8941	0.9767	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C08:01	MVDQPPDSV	0.8751	0.992	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-C07:04	MVDQPPDSV	0.2143	0.9419	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-B07:13	MVDQPPDSV	0.1619	0.8485	7	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:03	AMVDQPPDSV	0.9968	0.8149	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:14	AMVDQPPDSV	0.9935	0.6777	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-A02:06	AMVDQPPDSV	0.9933	0.7389	6	16
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	HLA-B35:09	QPPDSVEDEL	0.4156	0.9866	10	20

Top

Potential FusionNeoAntigen Information of ZNF430-KCNIP4 in HLA II

ZNF430-KCNIP4_21216990_20852290.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	DRB4-0101	RHAMVDQPPDSVEDE	4	19
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	DRB4-0103	RHAMVDQPPDSVEDE	4	19
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	DRB4-0104	RHAMVDQPPDSVEDE	4	19
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	DRB4-0104	KRHAMVDQPPDSVED	3	18
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	DRB4-0106	RHAMVDQPPDSVEDE	4	19
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	DRB4-0107	RHAMVDQPPDSVEDE	4	19
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	503	DRB4-0108	RHAMVDQPPDSVEDE	4	19

Top

Fusion breakpoint peptide structures of ZNF430-KCNIP4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
440	AMVDQPPDSVEDEL	ZNF430	KCNIP4	chr19	21216990	chr4	20852290	503

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF430-KCNIP4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	440	AMVDQPPDSVEDEL	-7.9962	-8.1096
HLA-B14:02	3BVN	440	AMVDQPPDSVEDEL	-5.70842	-6.74372
HLA-B52:01	3W39	440	AMVDQPPDSVEDEL	-6.83737	-6.95077
HLA-B52:01	3W39	440	AMVDQPPDSVEDEL	-4.4836	-5.5189
HLA-A11:01	4UQ2	440	AMVDQPPDSVEDEL	-10.0067	-10.1201
HLA-A11:01	4UQ2	440	AMVDQPPDSVEDEL	-9.03915	-10.0745
HLA-A24:02	5HGA	440	AMVDQPPDSVEDEL	-6.56204	-6.67544
HLA-A24:02	5HGA	440	AMVDQPPDSVEDEL	-5.42271	-6.45801
HLA-B44:05	3DX8	440	AMVDQPPDSVEDEL	-7.85648	-8.89178
HLA-B44:05	3DX8	440	AMVDQPPDSVEDEL	-5.3978	-5.5112
HLA-A02:01	6TDR	440	AMVDQPPDSVEDEL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ZNF430-KCNIP4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	10	20	QPPDSVEDEL	AACCCCCAGACAGCGTGGAAGATGAACTGG
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	6	16	AMVDQPPDSV	CGATGGTAGATCAACCCCCAGACAGCGTGG
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	7	16	MVDQPPDSV	TGGTAGATCAACCCCCAGACAGCGTGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	3	18	KRHAMVDQPPDSVED	AGAGACATGCGATGGTAGATCAACCCCCAGACAGCGTGGAAGATG
ZNF430-KCNIP4	chr19	21216990	chr4	20852290	4	19	RHAMVDQPPDSVEDE	GACATGCGATGGTAGATCAACCCCCAGACAGCGTGGAAGATGAAC

Top

Information of the samples that have these potential fusion neoantigens of ZNF430-KCNIP4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	ZNF430-KCNIP4	chr19	21216990	ENST00000261560	chr4	20852290	ENST00000382148	TCGA-GV-A3JZ-01A

Top

Potential target of CAR-T therapy development for ZNF430-KCNIP4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF430-KCNIP4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF430-KCNIP4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)