|
|||||||
|
Fusion Protein:BRD8-HDAC3 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: BRD8-HDAC3 | FusionPDB ID: 10215 | FusionGDB2.0 ID: 10215 | Hgene | Tgene | Gene symbol | BRD8 | HDAC3 | Gene ID | 10902 | 8841 |
| Gene name | bromodomain containing 8 | histone deacetylase 3 | |
| Synonyms | SMAP|SMAP2|p120 | HD3|KDAC3|RPD3|RPD3-2 | |
| Cytomap | 5q31.2 | 5q31.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | bromodomain-containing protein 8skeletal muscle abundant protein 2thyroid hormone receptor coactivating protein of 120 kDatrCP120 | histone deacetylase 3SMAP45 | |
| Modification date | 20200313 | 20200329 | |
| UniProtAcc | Q9H0E9 Main function of 5'-partner protein: FUNCTION: May act as a coactivator during transcriptional activation by hormone-activated nuclear receptors (NR). Isoform 2 stimulates transcriptional activation by AR/DHTR, ESR1/NR3A1, RXRA/NR2B1 and THRB/ERBA2. At least isoform 1 and isoform 2 are components of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage. Component of a SWR1-like complex that specifically mediates the removal of histone H2A.Z/H2AZ1 from the nucleosome. {ECO:0000269|PubMed:10517671, ECO:0000269|PubMed:14966270, ECO:0000269|PubMed:24463511}. | O15379 Main function of 5'-partner protein: FUNCTION: Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4), and some other non-histone substrates. Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Participates in the BCL6 transcriptional repressor activity by deacetylating the H3 'Lys-27' (H3K27) on enhancer elements, antagonizing EP300 acetyltransferase activity and repressing proximal gene expression. Probably participates in the regulation of transcription through its binding to the zinc-finger transcription factor YY1; increases YY1 repression activity. Required to repress transcription of the POU1F1 transcription factor. Acts as a molecular chaperone for shuttling phosphorylated NR2C1 to PML bodies for sumoylation (PubMed:21444723, PubMed:23911289). Contributes, together with XBP1 isoform 1, to the activation of NFE2L2-mediated HMOX1 transcription factor gene expression in a PI(3)K/mTORC2/Akt-dependent signaling pathway leading to endothelial cell (EC) survival under disturbed flow/oxidative stress (PubMed:25190803). Regulates both the transcriptional activation and repression phases of the circadian clock in a deacetylase activity-independent manner (By similarity). During the activation phase, promotes the accumulation of ubiquitinated ARNTL/BMAL1 at the E-boxes and during the repression phase, blocks FBXL3-mediated CRY1/2 ubiquitination and promotes the interaction of CRY1 and ARNTL/BMAL1 (By similarity). The NCOR1-HDAC3 complex regulates the circadian expression of the core clock gene ARTNL/BMAL1 and the genes involved in lipid metabolism in the liver (By similarity). Serves as a corepressor of RARA, causing its deacetylation and inhibition of RARE DNA element binding (PubMed:28167758). In association with RARA, plays a role in the repression of microRNA-10a and thereby in the inflammatory response (PubMed:28167758). Interacts with SETD5 (By similarity). {ECO:0000250|UniProtKB:O88895, ECO:0000269|PubMed:21444723, ECO:0000269|PubMed:23911289, ECO:0000269|PubMed:25190803, ECO:0000269|PubMed:28167758}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000230901, ENST00000254900, ENST00000402931, ENST00000411594, ENST00000455658, ENST00000515014, | ENST00000469207, ENST00000305264, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 5 X 5 X 3=75 | 3 X 3 X 3=27 |
| # samples | 5 | 3 | |
| ** MAII score | log2(5/75*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
| Fusion gene context | PubMed: BRD8 [Title/Abstract] AND HDAC3 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: BRD8 [Title/Abstract] AND HDAC3 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | BRD8(137513260)-HDAC3(141009692), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | BRD8-HDAC3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BRD8-HDAC3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | BRD8 | GO:0043967 | histone H4 acetylation | 14966270 |
| Hgene | BRD8 | GO:0043968 | histone H2A acetylation | 14966270 |
| Tgene | HDAC3 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 16569215|18417529|18854353 |
| Tgene | HDAC3 | GO:0001934 | positive regulation of protein phosphorylation | 25190803 |
| Tgene | HDAC3 | GO:0006476 | protein deacetylation | 17172643|21030595 |
| Tgene | HDAC3 | GO:0031647 | regulation of protein stability | 25190803 |
| Tgene | HDAC3 | GO:0042307 | positive regulation of protein import into nucleus | 25190803 |
| Tgene | HDAC3 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 25190803 |
| Tgene | HDAC3 | GO:0071498 | cellular response to fluid shear stress | 25190803 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:137513260/chr5:141009692) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across BRD8 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across HDAC3 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000254900 | BRD8 | chr5 | 137513260 | - | ENST00000305264 | HDAC3 | chr5 | 141009692 | - | 2086 | 488 | 372 | 1493 | 373 |
| ENST00000230901 | BRD8 | chr5 | 137513260 | - | ENST00000305264 | HDAC3 | chr5 | 141009692 | - | 1730 | 132 | 16 | 1137 | 373 |
| ENST00000402931 | BRD8 | chr5 | 137513260 | - | ENST00000305264 | HDAC3 | chr5 | 141009692 | - | 1733 | 135 | 19 | 1140 | 373 |
| ENST00000411594 | BRD8 | chr5 | 137513260 | - | ENST00000305264 | HDAC3 | chr5 | 141009692 | - | 1769 | 171 | 55 | 1176 | 373 |
| ENST00000455658 | BRD8 | chr5 | 137513260 | - | ENST00000305264 | HDAC3 | chr5 | 141009692 | - | 1729 | 131 | 15 | 1136 | 373 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000254900 | ENST00000305264 | BRD8 | chr5 | 137513260 | - | HDAC3 | chr5 | 141009692 | - | 0.001120593 | 0.9988794 |
| ENST00000230901 | ENST00000305264 | BRD8 | chr5 | 137513260 | - | HDAC3 | chr5 | 141009692 | - | 0.001512234 | 0.9984877 |
| ENST00000402931 | ENST00000305264 | BRD8 | chr5 | 137513260 | - | HDAC3 | chr5 | 141009692 | - | 0.00150817 | 0.99849176 |
| ENST00000411594 | ENST00000305264 | BRD8 | chr5 | 137513260 | - | HDAC3 | chr5 | 141009692 | - | 0.00160637 | 0.9983936 |
| ENST00000455658 | ENST00000305264 | BRD8 | chr5 | 137513260 | - | HDAC3 | chr5 | 141009692 | - | 0.001504651 | 0.99849534 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for BRD8-HDAC3 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| BRD8 | chr5 | 137513260 | HDAC3 | chr5 | 141009692 | 131 | 24 | STGPTEPWSIREKLCLASSVMRSGDQ |
| BRD8 | chr5 | 137513260 | HDAC3 | chr5 | 141009692 | 132 | 24 | STGPTEPWSIREKLCLASSVMRSGDQ |
| BRD8 | chr5 | 137513260 | HDAC3 | chr5 | 141009692 | 135 | 24 | STGPTEPWSIREKLCLASSVMRSGDQ |
| BRD8 | chr5 | 137513260 | HDAC3 | chr5 | 141009692 | 171 | 24 | STGPTEPWSIREKLCLASSVMRSGDQ |
| BRD8 | chr5 | 137513260 | HDAC3 | chr5 | 141009692 | 488 | 24 | STGPTEPWSIREKLCLASSVMRSGDQ |
Top |
Potential FusionNeoAntigen Information of BRD8-HDAC3 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| BRD8-HDAC3_137513260_141009692.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-A30:08 | SIREKLCLA | 0.9013 | 0.7255 | 8 | 17 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:03 | EPWSIREKL | 0.8963 | 0.7937 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:02 | EPWSIREKL | 0.7305 | 0.8579 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:04 | EPWSIREKL | 0.7305 | 0.8579 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-A74:09 | KLCLASSVMR | 0.9839 | 0.7611 | 12 | 22 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-A74:03 | KLCLASSVMR | 0.9839 | 0.7611 | 12 | 22 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-A74:11 | KLCLASSVMR | 0.9839 | 0.7611 | 12 | 22 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B42:02 | EPWSIREKL | 0.895 | 0.5203 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B42:01 | EPWSIREKL | 0.8472 | 0.5182 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:12 | EPWSIREKL | 0.7305 | 0.8579 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B39:10 | EPWSIREKL | 0.5237 | 0.8374 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B42:02 | TEPWSIREKL | 0.6366 | 0.5472 | 4 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B42:01 | TEPWSIREKL | 0.5829 | 0.5463 | 4 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:23 | EPWSIREKL | 0.9281 | 0.8209 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:24 | EPWSIREKL | 0.8736 | 0.878 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:30 | EPWSIREKL | 0.8115 | 0.6856 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:17 | EPWSIREKL | 0.8115 | 0.6856 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B35:09 | EPWSIREKL | 0.7305 | 0.8579 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B67:01 | EPWSIREKL | 0.6083 | 0.5496 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B08:12 | EPWSIREKL | 0.5168 | 0.6242 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B18:07 | EPWSIREKL | 0.1012 | 0.8858 | 5 | 14 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-A74:01 | KLCLASSVMR | 0.9839 | 0.7611 | 12 | 22 |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 | HLA-B40:04 | TEPWSIREKL | 0.9683 | 0.7168 | 4 | 14 |
Top |
Potential FusionNeoAntigen Information of BRD8-HDAC3 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of BRD8-HDAC3 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 7106 | PWSIREKLCLASSV | BRD8 | HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 132 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BRD8-HDAC3 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 7106 | PWSIREKLCLASSV | -6.66111 | -6.77451 |
| HLA-B14:02 | 3BVN | 7106 | PWSIREKLCLASSV | -6.49216 | -7.52746 |
| HLA-B52:01 | 3W39 | 7106 | PWSIREKLCLASSV | -5.57342 | -5.68682 |
| HLA-B52:01 | 3W39 | 7106 | PWSIREKLCLASSV | -3.59959 | -4.63489 |
| HLA-A11:01 | 4UQ2 | 7106 | PWSIREKLCLASSV | -3.54213 | -3.65553 |
| HLA-A24:02 | 5HGA | 7106 | PWSIREKLCLASSV | -7.6647 | -7.7781 |
| HLA-A24:02 | 5HGA | 7106 | PWSIREKLCLASSV | -4.05482 | -5.09012 |
| HLA-B44:05 | 3DX8 | 7106 | PWSIREKLCLASSV | -5.24587 | -5.35927 |
| HLA-B44:05 | 3DX8 | 7106 | PWSIREKLCLASSV | -4.91507 | -5.95037 |
| HLA-A02:01 | 6TDR | 7106 | PWSIREKLCLASSV | -3.67735 | -4.71265 |
Top |
Vaccine Design for the FusionNeoAntigens of BRD8-HDAC3 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 12 | 22 | KLCLASSVMR | TTGCCCAGTGTTTCCCGGGCTCTTTGAGTT |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 4 | 14 | TEPWSIREKL | TGTCATGAGAAGTGGCGATCAAAATTGCCC |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 5 | 14 | EPWSIREKL | CATGAGAAGTGGCGATCAAAATTGCCC |
| BRD8-HDAC3 | chr5 | 137513260 | chr5 | 141009692 | 8 | 17 | SIREKLCLA | TGGCGATCAAAATTGCCCAGTGTTTCC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of BRD8-HDAC3 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | BRD8-HDAC3 | chr5 | 137513260 | ENST00000230901 | chr5 | 141009692 | ENST00000305264 | TCGA-CD-8531-01A |
Top |
Potential target of CAR-T therapy development for BRD8-HDAC3 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to BRD8-HDAC3 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to BRD8-HDAC3 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies