Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BRD9-TERT

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BRD9-TERT
	FusionPDB ID: 10229
	FusionGDB2.0 ID: 10229
		Hgene	Tgene
	Gene symbol	BRD9	TERT
	Gene ID	65980	7015
	Gene name	bromodomain containing 9	telomerase reverse transcriptase
	Synonyms	LAVS3040\|PRO9856	CMM9\|DKCA2\|DKCB4\|EST2\|PFBMFT1\|TCS1\|TP2\|TRT\|hEST2\|hTRT
	Cytomap	5p15.33	5p15.33
	Type of gene	protein-coding	protein-coding
	Description	bromodomain-containing protein 9rhabdomyosarcoma antigen MU-RMS-40.8sarcoma antigen NY-SAR-29	telomerase reverse transcriptasetelomerase catalytic subunittelomerase-associated protein 2
	Modification date	20200315	20200329
	UniProtAcc	Q9H8M2 Main function of 5'-partner protein: FUNCTION: Plays a role in chromatin remodeling and regulation of transcription (PubMed:22464331, PubMed:26365797). Acts as a chromatin reader that recognizes and binds acylated histones: binds histones that are acetylated and/or butyrylated (PubMed:26365797). Component of SWI/SNF chromatin remodeling subcomplex GBAF that carries out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner (PubMed:29374058). Orchestrates also the RAD51-RAD54 complex formation and thereby plays a role in homologous recombination (HR) (PubMed:32457312). {ECO:0000269\|PubMed:22464331, ECO:0000269\|PubMed:26365797, ECO:0000269\|PubMed:29374058, ECO:0000269\|PubMed:32457312}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000323510, ENST00000388890, ENST00000435709, ENST00000467963, ENST00000483173, ENST00000494422,	ENST00000522877, ENST00000296820, ENST00000310581, ENST00000334602, ENST00000508104,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 15 X 7=1050	22 X 7 X 15=2310
	# samples	12	31
	** MAII score	log2(12/1050*10)=-3.12928301694497 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(31/2310*10)=-2.89755273102918 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: BRD9 [Title/Abstract] AND TERT [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BRD9 [Title/Abstract] AND TERT [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BRD9(889701)-TERT(1282739), # samples:2 BRD9(891269)-TERT(1282739), # samples:2
Anticipated loss of major functional domain due to fusion event.	BRD9-TERT seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BRD9-TERT seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BRD9-TERT seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BRD9-TERT seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BRD9-TERT seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. BRD9-TERT seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. BRD9-TERT seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. BRD9-TERT seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	TERT	GO:0001172	transcription, RNA-templated	19701182
Tgene	TERT	GO:0006278	RNA-dependent DNA biosynthetic process	9398860
Tgene	TERT	GO:0007004	telomere maintenance via telomerase	9443919\|16043710\|17940095\|19701182\|21531765\|29695869
Tgene	TERT	GO:0007005	mitochondrion organization	21937513
Tgene	TERT	GO:0010629	negative regulation of gene expression	11927518
Tgene	TERT	GO:0022616	DNA strand elongation	16043710
Tgene	TERT	GO:0030422	production of siRNA involved in RNA interference	19701182
Tgene	TERT	GO:0031647	regulation of protein stability	24415760\|26194824
Tgene	TERT	GO:0032092	positive regulation of protein binding	24415760
Tgene	TERT	GO:0051000	positive regulation of nitric-oxide synthase activity	11927518
Tgene	TERT	GO:0070200	establishment of protein localization to telomere	25589350
Tgene	TERT	GO:0071897	DNA biosynthetic process	9398860\|19701182
Tgene	TERT	GO:1903704	negative regulation of production of siRNA involved in RNA interference	19701182
Tgene	TERT	GO:1904751	positive regulation of protein localization to nucleolus	24415760
Tgene	TERT	GO:2000773	negative regulation of cellular senescence	11927518

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:889701/chr5:1282739)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BRD9 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TERT (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000388890	BRD9	chr5	889701	-	ENST00000296820	TERT	chr5	1282739	-	2311	113	770	1756	328
ENST00000323510	BRD9	chr5	889701	-	ENST00000296820	TERT	chr5	1282739	-	2311	113	770	1756	328
ENST00000483173	BRD9	chr5	889701	-	ENST00000310581	TERT	chr5	1282739	-	2834	447	104	2272	722
ENST00000483173	BRD9	chr5	889701	-	ENST00000334602	TERT	chr5	1282739	-	2084	447	104	2083	660
ENST00000483173	BRD9	chr5	889701	-	ENST00000508104	TERT	chr5	1282739	-	1360	447	104	1297	397
ENST00000435709	BRD9	chr5	889701	-	ENST00000310581	TERT	chr5	1282739	-	2966	579	485	2404	639
ENST00000435709	BRD9	chr5	889701	-	ENST00000334602	TERT	chr5	1282739	-	2216	579	485	2215	577
ENST00000435709	BRD9	chr5	889701	-	ENST00000508104	TERT	chr5	1282739	-	1492	579	485	1429	314
ENST00000483173	BRD9	chr5	891269	-	ENST00000296820	TERT	chr5	1282739	-	2584	386	22	1236	404
ENST00000467963	BRD9	chr5	891269	-	ENST00000310581	TERT	chr5	1282739	-	2954	567	167	2392	741
ENST00000467963	BRD9	chr5	891269	-	ENST00000334602	TERT	chr5	1282739	-	2204	567	167	2203	679
ENST00000467963	BRD9	chr5	891269	-	ENST00000508104	TERT	chr5	1282739	-	1480	567	167	1417	416
ENST00000483173	BRD9	chr5	891272	-	ENST00000296820	TERT	chr5	1282741	-	2584	386	22	1236	404
ENST00000467963	BRD9	chr5	891272	-	ENST00000310581	TERT	chr5	1282741	-	2954	567	167	2392	741
ENST00000467963	BRD9	chr5	891272	-	ENST00000334602	TERT	chr5	1282741	-	2204	567	167	2203	679
ENST00000467963	BRD9	chr5	891272	-	ENST00000508104	TERT	chr5	1282741	-	1480	567	167	1417	416
ENST00000388890	BRD9	chr5	889702	-	ENST00000296820	TERT	chr5	1282739	-	2311	113	770	1756	328
ENST00000323510	BRD9	chr5	889702	-	ENST00000296820	TERT	chr5	1282739	-	2311	113	770	1756	328
ENST00000483173	BRD9	chr5	889702	-	ENST00000310581	TERT	chr5	1282739	-	2834	447	104	2272	722
ENST00000483173	BRD9	chr5	889702	-	ENST00000334602	TERT	chr5	1282739	-	2084	447	104	2083	660
ENST00000483173	BRD9	chr5	889702	-	ENST00000508104	TERT	chr5	1282739	-	1360	447	104	1297	397
ENST00000435709	BRD9	chr5	889702	-	ENST00000310581	TERT	chr5	1282739	-	2966	579	485	2404	639
ENST00000435709	BRD9	chr5	889702	-	ENST00000334602	TERT	chr5	1282739	-	2216	579	485	2215	577
ENST00000435709	BRD9	chr5	889702	-	ENST00000508104	TERT	chr5	1282739	-	1492	579	485	1429	314
ENST00000467963	BRD9	chr5	892721	-	ENST00000296820	TERT	chr5	1282739	-	2417	219	876	1862	328
ENST00000483173	BRD9	chr5	891270	-	ENST00000296820	TERT	chr5	1282739	-	2584	386	22	1236	404
ENST00000467963	BRD9	chr5	891270	-	ENST00000310581	TERT	chr5	1282739	-	2954	567	167	2392	741
ENST00000467963	BRD9	chr5	891270	-	ENST00000334602	TERT	chr5	1282739	-	2204	567	167	2203	679
ENST00000467963	BRD9	chr5	891270	-	ENST00000508104	TERT	chr5	1282739	-	1480	567	167	1417	416

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000388890	ENST00000296820	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.10694734	0.89305264
ENST00000323510	ENST00000296820	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.10694734	0.89305264
ENST00000483173	ENST00000310581	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.030451426	0.9695486
ENST00000483173	ENST00000334602	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.046377804	0.95362216
ENST00000483173	ENST00000508104	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.08088696	0.91911304
ENST00000435709	ENST00000310581	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.020917531	0.97908247
ENST00000435709	ENST00000334602	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.038608063	0.9613919
ENST00000435709	ENST00000508104	BRD9	chr5	889701	-	TERT	chr5	1282739	-	0.036884245	0.96311575
ENST00000483173	ENST00000296820	BRD9	chr5	891269	-	TERT	chr5	1282739	-	0.08003991	0.9199601
ENST00000467963	ENST00000310581	BRD9	chr5	891269	-	TERT	chr5	1282739	-	0.011586408	0.98841363
ENST00000467963	ENST00000334602	BRD9	chr5	891269	-	TERT	chr5	1282739	-	0.02366183	0.9763382
ENST00000467963	ENST00000508104	BRD9	chr5	891269	-	TERT	chr5	1282739	-	0.007300607	0.99269944
ENST00000483173	ENST00000296820	BRD9	chr5	891272	-	TERT	chr5	1282741	-	0.08003991	0.9199601
ENST00000467963	ENST00000310581	BRD9	chr5	891272	-	TERT	chr5	1282741	-	0.011586408	0.98841363
ENST00000467963	ENST00000334602	BRD9	chr5	891272	-	TERT	chr5	1282741	-	0.02366183	0.9763382
ENST00000467963	ENST00000508104	BRD9	chr5	891272	-	TERT	chr5	1282741	-	0.007300607	0.99269944
ENST00000388890	ENST00000296820	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.10694734	0.89305264
ENST00000323510	ENST00000296820	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.10694734	0.89305264
ENST00000483173	ENST00000310581	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.030451426	0.9695486
ENST00000483173	ENST00000334602	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.046377804	0.95362216
ENST00000483173	ENST00000508104	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.08088696	0.91911304
ENST00000435709	ENST00000310581	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.020917531	0.97908247
ENST00000435709	ENST00000334602	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.038608063	0.9613919
ENST00000435709	ENST00000508104	BRD9	chr5	889702	-	TERT	chr5	1282739	-	0.036884245	0.96311575
ENST00000467963	ENST00000296820	BRD9	chr5	892721	-	TERT	chr5	1282739	-	0.0922473	0.9077527
ENST00000483173	ENST00000296820	BRD9	chr5	891270	-	TERT	chr5	1282739	-	0.08003991	0.9199601
ENST00000467963	ENST00000310581	BRD9	chr5	891270	-	TERT	chr5	1282739	-	0.011586408	0.98841363
ENST00000467963	ENST00000334602	BRD9	chr5	891270	-	TERT	chr5	1282739	-	0.02366183	0.9763382
ENST00000467963	ENST00000508104	BRD9	chr5	891270	-	TERT	chr5	1282739	-	0.007300607	0.99269944

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BRD9-TERT

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BRD9	chr5	889701	TERT	chr5	1282739	447	114	FSNSWNTSSASFRGVGCVPAAEHRLR
BRD9	chr5	889701	TERT	chr5	1282739	579	31	FSNSWNTSSASFRGVGCVPAAEHRLR
BRD9	chr5	889702	TERT	chr5	1282739	447	114	FSNSWNTSSASFRGVGCVPAAEHRLR
BRD9	chr5	889702	TERT	chr5	1282739	579	31	FSNSWNTSSASFRGVGCVPAAEHRLR
BRD9	chr5	891269	TERT	chr5	1282739	386	121	PPDRPVRACRTQPGVGCVPAAEHRLR
BRD9	chr5	891269	TERT	chr5	1282739	567	133	PPDRPVRACRTQPGVGCVPAAEHRLR
BRD9	chr5	891270	TERT	chr5	1282739	386	121	PPDRPVRACRTQPGVGCVPAAEHRLR
BRD9	chr5	891270	TERT	chr5	1282739	567	133	PPDRPVRACRTQPGVGCVPAAEHRLR
BRD9	chr5	891272	TERT	chr5	1282741	386	121	PPDRPVRACRTQPGVGCVPAAEHRLR
BRD9	chr5	891272	TERT	chr5	1282741	567	133	PPDRPVRACRTQPGVGCVPAAEHRLR

Top

Potential FusionNeoAntigen Information of BRD9-TERT in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BRD9-TERT_889701_1282739.msa
BRD9-TERT_891269_1282739.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BRD9-TERT	chr5	889701	chr5	1282739	579	HLA-B73:01	FRGVGCVPA	0.9438	0.9606	11	20
BRD9-TERT	chr5	889701	chr5	1282739	579	HLA-C15:02	TSSASFRGV	0.9991	0.7923	6	15
BRD9-TERT	chr5	891269	chr5	1282739	567	HLA-B56:01	QPGVGCVPA	0.8189	0.752	11	20
BRD9-TERT	chr5	891269	chr5	1282739	567	HLA-B56:01	QPGVGCVPAA	0.7156	0.8645	11	21
BRD9-TERT	chr5	891269	chr5	1282739	567	HLA-B54:01	QPGVGCVPAA	0.8991	0.9477	11	21
BRD9-TERT	chr5	891269	chr5	1282739	567	HLA-C15:02	RTQPGVGCV	0.9983	0.94	9	18
BRD9-TERT	chr5	891269	chr5	1282739	567	HLA-B55:02	QPGVGCVPA	0.8252	0.7405	11	20
BRD9-TERT	chr5	891269	chr5	1282739	567	HLA-B55:02	QPGVGCVPAA	0.7965	0.8606	11	21

Top

Potential FusionNeoAntigen Information of BRD9-TERT in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of BRD9-TERT

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7673	RACRTQPGVGCVPA	BRD9	TERT	chr5	891269	chr5	1282739	567

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9665	TSSASFRGVGCVPA	BRD9	TERT	chr5	889701	chr5	1282739	579

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BRD9-TERT

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7673	RACRTQPGVGCVPA	-7.15543	-7.26883
HLA-B14:02	3BVN	7673	RACRTQPGVGCVPA	-4.77435	-5.80965
HLA-B52:01	3W39	7673	RACRTQPGVGCVPA	-6.80875	-6.92215
HLA-B52:01	3W39	7673	RACRTQPGVGCVPA	-4.20386	-5.23916
HLA-A11:01	4UQ2	7673	RACRTQPGVGCVPA	-7.5194	-8.5547
HLA-A11:01	4UQ2	7673	RACRTQPGVGCVPA	-6.9601	-7.0735
HLA-A24:02	5HGA	7673	RACRTQPGVGCVPA	-7.52403	-7.63743
HLA-A24:02	5HGA	7673	RACRTQPGVGCVPA	-5.82433	-6.85963
HLA-B27:05	6PYJ	7673	RACRTQPGVGCVPA	-3.28285	-4.31815
HLA-B44:05	3DX8	7673	RACRTQPGVGCVPA	-5.91172	-6.94702
HLA-B44:05	3DX8	7673	RACRTQPGVGCVPA	-4.24346	-4.35686
HLA-B14:02	3BVN	9665	TSSASFRGVGCVPA	-6.9015	-7.0162
HLA-B14:02	3BVN	9665	TSSASFRGVGCVPA	-6.88733	-7.92393
HLA-B52:01	3W39	9665	TSSASFRGVGCVPA	-6.20276	-6.31746
HLA-B52:01	3W39	9665	TSSASFRGVGCVPA	-3.23728	-4.27388
HLA-A24:02	5HGA	9665	TSSASFRGVGCVPA	-6.25402	-7.29062
HLA-A24:02	5HGA	9665	TSSASFRGVGCVPA	-5.4385	-5.5532
HLA-B44:05	3DX8	9665	TSSASFRGVGCVPA	-6.77944	-6.89414
HLA-B44:05	3DX8	9665	TSSASFRGVGCVPA	-5.78397	-6.82057
HLA-A02:01	6TDR	9665	TSSASFRGVGCVPA	-2.00985	-3.04645

Top

Vaccine Design for the FusionNeoAntigens of BRD9-TERT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BRD9-TERT	chr5	889701	chr5	1282739	11	20	FRGVGCVPA	TCAGAGGGGTTGGCTGTGTTCCGGCCG
BRD9-TERT	chr5	889701	chr5	1282739	6	15	TSSASFRGV	CTTCCTCCGCCAGCTTCAGAGGGGTTG
BRD9-TERT	chr5	891269	chr5	1282739	11	20	QPGVGCVPA	AGCCAGGGGTTGGCTGTGTTCCGGCCG
BRD9-TERT	chr5	891269	chr5	1282739	11	21	QPGVGCVPAA	AGCCAGGGGTTGGCTGTGTTCCGGCCGCAG
BRD9-TERT	chr5	891269	chr5	1282739	9	18	RTQPGVGCV	GGACACAGCCAGGGGTTGGCTGTGTTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of BRD9-TERT

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	BRD9-TERT	chr5	889701	ENST00000435709	chr5	1282739	ENST00000310581	TCGA-R6-A8W5
ESCA	BRD9-TERT	chr5	891269	ENST00000467963	chr5	1282739	ENST00000310581	TCGA-R6-A8W5

Top

Potential target of CAR-T therapy development for BRD9-TERT

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BRD9-TERT

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BRD9-TERT

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	BRD9	C0036920	Sezary Syndrome	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)