Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF562-HK2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF562-HK2
	FusionPDB ID: 102376
	FusionGDB2.0 ID: 102376
		Hgene	Tgene
	Gene symbol	ZNF562	HK2
	Gene ID	54811	29911
	Gene name	zinc finger protein 562	hook microtubule tethering protein 2
	Synonyms	-	HK2
	Cytomap	19p13.2	19p13.13
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 562	protein Hook homolog 2h-hook2hHK2hook homolog 2
	Modification date	20200313	20200327
	UniProtAcc	.	P52789 Main function of 5'-partner protein: FUNCTION: Catalyzes the phosphorylation of hexose, such as D-glucose and D-fructose, to hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively) (PubMed:23185017, PubMed:26985301, PubMed:29298880). Mediates the initial step of glycolysis by catalyzing phosphorylation of D-glucose to D-glucose 6-phosphate (PubMed:29298880). Plays a key role in maintaining the integrity of the outer mitochondrial membrane by preventing the release of apoptogenic molecules from the intermembrane space and subsequent apoptosis (PubMed:18350175). {ECO:0000269\|PubMed:18350175, ECO:0000269\|PubMed:23185017, ECO:0000269\|PubMed:26985301, ECO:0000269\|PubMed:29298880}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000448622, ENST00000453372, ENST00000453792, ENST00000541032, ENST00000587392, ENST00000590155, ENST00000293648, ENST00000537617,	ENST00000290573, ENST00000409174,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 6 X 5=210	3 X 3 X 3=27
	# samples	6	3
	** MAII score	log2(6/210*10)=-1.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: ZNF562 [Title/Abstract] AND HK2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF562 [Title/Abstract] AND HK2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF562(9768685)-HK2(75099427), # samples:1
Anticipated loss of major functional domain due to fusion event.	ZNF562-HK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF562-HK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF562-HK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF562-HK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF562-HK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ZNF562-HK2 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. ZNF562-HK2 seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:9768685/chr2:75099427)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF562 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across HK2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000453372	ZNF562	chr19	9768685	-	ENST00000290573	HK2	chr2	75099427	+	5198	401	395	2779	794
ENST00000453372	ZNF562	chr19	9768685	-	ENST00000409174	HK2	chr2	75099427	+	5198	401	395	2779	794
ENST00000541032	ZNF562	chr19	9768685	-	ENST00000290573	HK2	chr2	75099427	+	5151	354	348	2732	794
ENST00000541032	ZNF562	chr19	9768685	-	ENST00000409174	HK2	chr2	75099427	+	5151	354	348	2732	794
ENST00000590155	ZNF562	chr19	9768685	-	ENST00000290573	HK2	chr2	75099427	+	5236	439	433	2817	794
ENST00000590155	ZNF562	chr19	9768685	-	ENST00000409174	HK2	chr2	75099427	+	5236	439	433	2817	794
ENST00000453792	ZNF562	chr19	9768685	-	ENST00000290573	HK2	chr2	75099427	+	5010	213	207	2591	794
ENST00000453792	ZNF562	chr19	9768685	-	ENST00000409174	HK2	chr2	75099427	+	5010	213	207	2591	794
ENST00000587392	ZNF562	chr19	9768685	-	ENST00000290573	HK2	chr2	75099427	+	5206	409	403	2787	794
ENST00000587392	ZNF562	chr19	9768685	-	ENST00000409174	HK2	chr2	75099427	+	5206	409	403	2787	794

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000453372	ENST00000290573	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000445389	0.9995546
ENST00000453372	ENST00000409174	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000445389	0.9995546
ENST00000541032	ENST00000290573	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000452987	0.99954695
ENST00000541032	ENST00000409174	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000452987	0.99954695
ENST00000590155	ENST00000290573	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000447696	0.9995523
ENST00000590155	ENST00000409174	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000447696	0.9995523
ENST00000453792	ENST00000290573	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000421868	0.9995782
ENST00000453792	ENST00000409174	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000421868	0.9995782
ENST00000587392	ENST00000290573	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000434373	0.99956566
ENST00000587392	ENST00000409174	ZNF562	chr19	9768685	-	HK2	chr2	75099427	+	0.000434373	0.99956566

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF562-HK2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF562	chr19	9768685	HK2	chr2	75099427	213	400	MLPTYVCATPDGTEKGDFLALDLGGT
ZNF562	chr19	9768685	HK2	chr2	75099427	354	400	MLPTYVCATPDGTEKGDFLALDLGGT
ZNF562	chr19	9768685	HK2	chr2	75099427	401	400	MLPTYVCATPDGTEKGDFLALDLGGT
ZNF562	chr19	9768685	HK2	chr2	75099427	409	400	MLPTYVCATPDGTEKGDFLALDLGGT
ZNF562	chr19	9768685	HK2	chr2	75099427	439	400	MLPTYVCATPDGTEKGDFLALDLGGT

Top

Potential FusionNeoAntigen Information of ZNF562-HK2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF562-HK2_9768685_75099427.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B50:02	TEKGDFLAL	0.9867	0.7385	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B47:01	TEKGDFLAL	0.9729	0.7117	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B44:03	TEKGDFLAL	0.9569	0.9739	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:01	TEKGDFLAL	0.8883	0.8931	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B45:01	TEKGDFLAL	0.8829	0.9438	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:13	TEKGDFLAL	0.552	0.9678	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B41:01	TEKGDFLAL	0.5332	0.9331	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B50:01	TEKGDFLAL	0.3742	0.7902	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B15:37	TEKGDFLAL	0.3378	0.6542	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B35:08	TPDGTEKGDF	0.9148	0.7485	8	18
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B40:01	GTEKGDFLAL	0.5878	0.6193	11	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B35:03	TPDGTEKGDFL	0.9845	0.7774	8	19
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B35:04	TPDGTEKGDFL	0.9665	0.9646	8	19
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B35:02	TPDGTEKGDFL	0.9665	0.9646	8	19
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B40:06	TEKGDFLAL	0.9994	0.6529	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B44:10	TEKGDFLAL	0.9939	0.5705	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:08	TEKGDFLAL	0.7155	0.9311	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:09	TEKGDFLAL	0.6282	0.8773	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:05	TEKGDFLAL	0.5291	0.9688	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:12	TEKGDFLAL	0.5193	0.9748	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B40:03	GTEKGDFLAL	0.817	0.5422	11	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B35:12	TPDGTEKGDFL	0.9665	0.9646	8	19
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:10	TPDGTEKGDFL	0.9367	0.9183	8	19
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B40:04	TEKGDFLAL	0.9994	0.762	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B44:26	TEKGDFLAL	0.9569	0.9739	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B44:13	TEKGDFLAL	0.9569	0.9739	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B44:07	TEKGDFLAL	0.9569	0.9739	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:07	TEKGDFLAL	0.9117	0.8008	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:04	TEKGDFLAL	0.9041	0.8915	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:05	TEKGDFLAL	0.8883	0.8931	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:06	TEKGDFLAL	0.8837	0.9148	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:08	TEKGDFLAL	0.8744	0.9203	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:03	TEKGDFLAL	0.8729	0.8848	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B41:03	TEKGDFLAL	0.8435	0.6551	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:11	TEKGDFLAL	0.7325	0.8916	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:11	TEKGDFLAL	0.6878	0.9105	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:31	TEKGDFLAL	0.609	0.9731	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B39:02	TEKGDFLAL	0.5856	0.9709	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B50:05	TEKGDFLAL	0.3742	0.7902	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B50:04	TEKGDFLAL	0.3742	0.7902	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B48:02	TEKGDFLAL	0.3275	0.9086	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B15:54	TEKGDFLAL	0.2768	0.8353	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B15:53	TEKGDFLAL	0.1614	0.8426	12	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B40:04	GTEKGDFLAL	0.665	0.7879	11	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B40:49	GTEKGDFLAL	0.6206	0.642	11	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B40:36	GTEKGDFLAL	0.576	0.6033	11	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B41:03	GTEKGDFLAL	0.4784	0.7319	11	21
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B35:09	TPDGTEKGDFL	0.9665	0.9646	8	19
ZNF562-HK2	chr19	9768685	chr2	75099427	401	HLA-B18:03	DGTEKGDFLAL	0.9447	0.8324	10	21

Top

Potential FusionNeoAntigen Information of ZNF562-HK2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ZNF562-HK2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
769	CATPDGTEKGDFLA	ZNF562	HK2	chr19	9768685	chr2	75099427	401

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF562-HK2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	769	CATPDGTEKGDFLA	-7.9962	-8.1096
HLA-B14:02	3BVN	769	CATPDGTEKGDFLA	-5.70842	-6.74372
HLA-B52:01	3W39	769	CATPDGTEKGDFLA	-6.83737	-6.95077
HLA-B52:01	3W39	769	CATPDGTEKGDFLA	-4.4836	-5.5189
HLA-A11:01	4UQ2	769	CATPDGTEKGDFLA	-10.0067	-10.1201
HLA-A11:01	4UQ2	769	CATPDGTEKGDFLA	-9.03915	-10.0745
HLA-A24:02	5HGA	769	CATPDGTEKGDFLA	-6.56204	-6.67544
HLA-A24:02	5HGA	769	CATPDGTEKGDFLA	-5.42271	-6.45801
HLA-B44:05	3DX8	769	CATPDGTEKGDFLA	-7.85648	-8.89178
HLA-B44:05	3DX8	769	CATPDGTEKGDFLA	-5.3978	-5.5112
HLA-A02:01	6TDR	769	CATPDGTEKGDFLA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ZNF562-HK2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF562-HK2	chr19	9768685	chr2	75099427	10	21	DGTEKGDFLAL	CCTCTGTGGCTGTTTGACCACATTGCCGAATGC
ZNF562-HK2	chr19	9768685	chr2	75099427	11	21	GTEKGDFLAL	CTGTGGCTGTTTGACCACATTGCCGAATGC
ZNF562-HK2	chr19	9768685	chr2	75099427	12	21	TEKGDFLAL	TGGCTGTTTGACCACATTGCCGAATGC
ZNF562-HK2	chr19	9768685	chr2	75099427	8	18	TPDGTEKGDF	ACCTGGCCTCTGTGGCTGTTTGACCACATT
ZNF562-HK2	chr19	9768685	chr2	75099427	8	19	TPDGTEKGDFL	ACCTGGCCTCTGTGGCTGTTTGACCACATTGCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ZNF562-HK2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	ZNF562-HK2	chr19	9768685	ENST00000453372	chr2	75099427	ENST00000290573	TCGA-L5-A891

Top

Potential target of CAR-T therapy development for ZNF562-HK2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF562-HK2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF562-HK2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)