Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF814-EIF3B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF814-EIF3B
	FusionPDB ID: 103004
	FusionGDB2.0 ID: 103004
		Hgene	Tgene
	Gene symbol	ZNF814	EIF3B
	Gene ID	730051	8662
	Gene name	zinc finger protein 814	eukaryotic translation initiation factor 3 subunit B
	Synonyms	-	EIF3-ETA\|EIF3-P110\|EIF3-P116\|EIF3S9\|PRT1
	Cytomap	19q13.43	7p22.3
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 814	eukaryotic translation initiation factor 3 subunit Beukaryotic translation initiation factor 3 subunit 9eukaryotic translation initiation factor 3, subunit 9 (eta, 116kD)eukaryotic translation initiation factor 3, subunit 9 eta, 116kDaprt1 homolog
	Modification date	20200313	20200322
	UniProtAcc	.	P55884 Main function of 5'-partner protein: FUNCTION: RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:9388245, PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:9388245, PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773). {ECO:0000255\|HAMAP-Rule:MF_03001, ECO:0000269\|PubMed:17581632, ECO:0000269\|PubMed:25849773, ECO:0000269\|PubMed:27462815, ECO:0000269\|PubMed:9388245}.; FUNCTION: (Microbial infection) In case of FCV infection, plays a role in the ribosomal termination-reinitiation event leading to the translation of VP2 (PubMed:18056426). {ECO:0000269\|PubMed:18056426}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000435989, ENST00000595295, ENST00000596604, ENST00000597342, ENST00000597807, ENST00000597832, ENST00000600634, ENST00000597652,	ENST00000360876, ENST00000397011,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 5 X 4=120	16 X 22 X 8=2816
	# samples	7	22
	** MAII score	log2(7/120*10)=-0.777607578663552 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(22/2816*10)=-3.67807190511264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF814 [Title/Abstract] AND EIF3B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF814 [Title/Abstract] AND EIF3B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF814(58400135)-EIF3B(2416585), # samples:1
Anticipated loss of major functional domain due to fusion event.	ZNF814-EIF3B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF814-EIF3B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	EIF3B	GO:0006413	translational initiation	8995410\|17581632
Tgene	EIF3B	GO:0006446	regulation of translational initiation	8995410
Tgene	EIF3B	GO:0075522	IRES-dependent viral translational initiation	9573242
Tgene	EIF3B	GO:0075525	viral translational termination-reinitiation	21347434

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:58400135/chr7:2416585)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF814 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EIF3B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000596604	ZNF814	chr19	58400135	-	ENST00000360876	EIF3B	chr7	2416585	+	1125	154	34	570	178
ENST00000596604	ZNF814	chr19	58400135	-	ENST00000397011	EIF3B	chr7	2416585	+	1052	154	34	570	178
ENST00000597342	ZNF814	chr19	58400135	-	ENST00000360876	EIF3B	chr7	2416585	+	1163	192	36	608	190
ENST00000597342	ZNF814	chr19	58400135	-	ENST00000397011	EIF3B	chr7	2416585	+	1090	192	36	608	190
ENST00000597832	ZNF814	chr19	58400135	-	ENST00000360876	EIF3B	chr7	2416585	+	1224	253	97	669	190
ENST00000597832	ZNF814	chr19	58400135	-	ENST00000397011	EIF3B	chr7	2416585	+	1151	253	97	669	190
ENST00000595295	ZNF814	chr19	58400135	-	ENST00000360876	EIF3B	chr7	2416585	+	1026	55	967	446	173
ENST00000595295	ZNF814	chr19	58400135	-	ENST00000397011	EIF3B	chr7	2416585	+	953	55	19	471	150
ENST00000600634	ZNF814	chr19	58400135	-	ENST00000360876	EIF3B	chr7	2416585	+	1022	51	963	442	173
ENST00000600634	ZNF814	chr19	58400135	-	ENST00000397011	EIF3B	chr7	2416585	+	949	51	15	467	150
ENST00000435989	ZNF814	chr19	58400135	-	ENST00000360876	EIF3B	chr7	2416585	+	1242	271	115	687	190
ENST00000435989	ZNF814	chr19	58400135	-	ENST00000397011	EIF3B	chr7	2416585	+	1169	271	115	687	190
ENST00000597807	ZNF814	chr19	58400135	-	ENST00000360876	EIF3B	chr7	2416585	+	1174	203	47	619	190
ENST00000597807	ZNF814	chr19	58400135	-	ENST00000397011	EIF3B	chr7	2416585	+	1101	203	47	619	190

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000596604	ENST00000360876	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.005236101	0.99476385
ENST00000596604	ENST00000397011	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.00573713	0.9942629
ENST00000597342	ENST00000360876	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.005800227	0.99419975
ENST00000597342	ENST00000397011	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.005192303	0.99480766
ENST00000597832	ENST00000360876	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.004901311	0.99509865
ENST00000597832	ENST00000397011	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.004659319	0.9953407
ENST00000595295	ENST00000360876	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.004332333	0.9956677
ENST00000595295	ENST00000397011	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.004142241	0.9958578
ENST00000600634	ENST00000360876	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.004423915	0.99557614
ENST00000600634	ENST00000397011	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.004521477	0.9954786
ENST00000435989	ENST00000360876	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.003848108	0.99615186
ENST00000435989	ENST00000397011	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.004692748	0.99530727
ENST00000597807	ENST00000360876	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.00602846	0.9939715
ENST00000597807	ENST00000397011	ZNF814	chr19	58400135	-	EIF3B	chr7	2416585	+	0.006987726	0.99301225

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF814-EIF3B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF814	chr19	58400135	EIF3B	chr7	2416585	154	38	RGSMAAAATLRLSAQVDNAYWLWTFQ
ZNF814	chr19	58400135	EIF3B	chr7	2416585	192	50	RGSMAAAATLRLSAQVDNAYWLWTFQ
ZNF814	chr19	58400135	EIF3B	chr7	2416585	203	50	RGSMAAAATLRLSAQVDNAYWLWTFQ
ZNF814	chr19	58400135	EIF3B	chr7	2416585	253	50	RGSMAAAATLRLSAQVDNAYWLWTFQ
ZNF814	chr19	58400135	EIF3B	chr7	2416585	271	50	RGSMAAAATLRLSAQVDNAYWLWTFQ

Top

Potential FusionNeoAntigen Information of ZNF814-EIF3B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF814-EIF3B_58400135_2416585.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:01	SAQVDNAYW	0.9946	0.9669	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:25	LSAQVDNAY	0.9922	0.915	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:01	LSAQVDNAY	0.988	0.888	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:01	SAQVDNAYW	0.9865	0.9894	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:02	LSAQVDNAY	0.9816	0.9268	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:17	LSAQVDNAY	0.9713	0.8903	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:02	SAQVDNAYW	0.9643	0.9801	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:08	LSAQVDNAY	0.9518	0.8851	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:01	LSAQVDNAY	0.9138	0.9311	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:03	SAQVDNAYW	0.8986	0.992	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:16	LSAQVDNAY	0.8878	0.7313	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:05	LSAQVDNAY	0.7403	0.7141	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:01	RLSAQVDNAY	0.9997	0.9111	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:01	LSAQVDNAYW	0.9996	0.9909	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:01	LSAQVDNAYW	0.9994	0.9695	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:02	LSAQVDNAYW	0.999	0.9783	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:03	LSAQVDNAYW	0.9932	0.9947	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:25	RLSAQVDNAY	0.9924	0.9513	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B27:02	LRLSAQVDNAY	1	0.7342	9	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:01	SAQVDNAYWLW	0.9997	0.9941	12	23
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:01	RLSAQVDNAYW	0.9996	0.9943	10	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:01	RLSAQVDNAYW	0.9988	0.9874	10	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:01	SAQVDNAYWLW	0.9985	0.9881	12	23
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:03	RLSAQVDNAYW	0.9946	0.995	10	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:03	SAQVDNAYWLW	0.9925	0.9962	12	23
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:21	LSAQVDNAY	0.9803	0.9139	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:05	LSAQVDNAY	0.962	0.9103	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:31	LSAQVDNAY	0.9263	0.914	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-C03:14	LSAQVDNAY	0.1287	0.9676	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:07	RLSAQVDNAY	0.9954	0.6315	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:04	RLSAQVDNAY	0.9847	0.9346	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:05	RLSAQVDNAY	0.915	0.9339	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-C15:02	ATLRLSAQV	0.9995	0.8931	7	16
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:04	SAQVDNAYW	0.9946	0.8131	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:39	LSAQVDNAY	0.9921	0.8304	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:27	LSAQVDNAY	0.989	0.8894	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:33	LSAQVDNAY	0.988	0.888	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:125	LSAQVDNAY	0.988	0.888	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:34	LSAQVDNAY	0.988	0.888	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:10	SAQVDNAYW	0.9865	0.9894	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:135	LSAQVDNAY	0.9863	0.8972	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:11	LSAQVDNAY	0.9769	0.8627	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:11	LSAQVDNAY	0.9753	0.9154	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:08	LSAQVDNAY	0.9742	0.8636	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:50	LSAQVDNAY	0.9682	0.9061	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:06	SAQVDNAYW	0.9654	0.9208	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:20	LSAQVDNAY	0.9634	0.9439	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:43	LSAQVDNAY	0.9571	0.8705	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:02	SAQVDNAYW	0.9571	0.9433	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:28	LSAQVDNAY	0.9477	0.9504	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:12	LSAQVDNAY	0.946	0.9006	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-A69:01	ATLRLSAQV	0.9417	0.5945	7	16
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:20	LSAQVDNAY	0.9207	0.957	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:23	LSAQVDNAY	0.9171	0.9299	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:77	LSAQVDNAY	0.9138	0.9311	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:13	SAQVDNAYW	0.9108	0.6966	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-C03:02	LSAQVDNAY	0.9108	0.9618	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B53:02	SAQVDNAYW	0.8554	0.5217	12	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:17	LSAQVDNAY	0.7798	0.8685	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:30	LSAQVDNAY	0.7798	0.8685	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:24	LSAQVDNAY	0.7507	0.9435	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-C12:02	LSAQVDNAY	0.5078	0.9608	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-C16:04	LSAQVDNAY	0.2295	0.9715	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-C16:01	LSAQVDNAY	0.0311	0.9737	11	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:33	RLSAQVDNAY	0.9997	0.9111	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:34	RLSAQVDNAY	0.9997	0.9111	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:125	RLSAQVDNAY	0.9997	0.9111	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:04	LSAQVDNAYW	0.9997	0.8323	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:135	RLSAQVDNAY	0.9996	0.9204	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:27	RLSAQVDNAY	0.9996	0.9255	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:10	LSAQVDNAYW	0.9996	0.9909	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:50	RLSAQVDNAY	0.9995	0.9035	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:12	RLSAQVDNAY	0.9991	0.8579	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B58:06	LSAQVDNAYW	0.9982	0.9127	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:02	LSAQVDNAYW	0.9981	0.9532	11	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:35	RLSAQVDNAY	0.9954	0.8261	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:39	RLSAQVDNAY	0.9925	0.8701	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B15:20	RLSAQVDNAY	0.9241	0.9614	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B35:28	RLSAQVDNAY	0.8851	0.9633	10	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B27:08	LRLSAQVDNAY	0.9999	0.8415	9	20
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:10	SAQVDNAYWLW	0.9997	0.9941	12	23
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:04	SAQVDNAYWLW	0.9997	0.8955	12	23
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:04	RLSAQVDNAYW	0.9996	0.8296	10	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:10	RLSAQVDNAYW	0.9996	0.9943	10	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:02	SAQVDNAYWLW	0.9974	0.9778	12	23
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-A32:01	RLSAQVDNAYW	0.997	0.9571	10	21
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	HLA-B57:02	RLSAQVDNAYW	0.9961	0.9681	10	21

Top

Potential FusionNeoAntigen Information of ZNF814-EIF3B in HLA II

ZNF814-EIF3B_58400135_2416585.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	DRB1-0478	RGSMAAAATLRLSAQ	0	15
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	DRB1-0901	RGSMAAAATLRLSAQ	0	15
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	DRB1-0906	RGSMAAAATLRLSAQ	0	15
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	DRB1-0907	RGSMAAAATLRLSAQ	0	15
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	DRB1-0909	RGSMAAAATLRLSAQ	0	15
ZNF814-EIF3B	chr19	58400135	chr7	2416585	271	DRB1-1410	RGSMAAAATLRLSAQ	0	15

Top

Fusion breakpoint peptide structures of ZNF814-EIF3B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
77	AATLRLSAQVDNAY	ZNF814	EIF3B	chr19	58400135	chr7	2416585	271

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF814-EIF3B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	77	AATLRLSAQVDNAY	-7.9962	-8.1096
HLA-B14:02	3BVN	77	AATLRLSAQVDNAY	-5.70842	-6.74372
HLA-B52:01	3W39	77	AATLRLSAQVDNAY	-6.83737	-6.95077
HLA-B52:01	3W39	77	AATLRLSAQVDNAY	-4.4836	-5.5189
HLA-A11:01	4UQ2	77	AATLRLSAQVDNAY	-10.0067	-10.1201
HLA-A11:01	4UQ2	77	AATLRLSAQVDNAY	-9.03915	-10.0745
HLA-A24:02	5HGA	77	AATLRLSAQVDNAY	-6.56204	-6.67544
HLA-A24:02	5HGA	77	AATLRLSAQVDNAY	-5.42271	-6.45801
HLA-B44:05	3DX8	77	AATLRLSAQVDNAY	-7.85648	-8.89178
HLA-B44:05	3DX8	77	AATLRLSAQVDNAY	-5.3978	-5.5112
HLA-A02:01	6TDR	77	AATLRLSAQVDNAY	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ZNF814-EIF3B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF814-EIF3B	chr19	58400135	chr7	2416585	10	20	RLSAQVDNAY	TCCGCTCAGGTGGACAACGCGTACTGGCTG
ZNF814-EIF3B	chr19	58400135	chr7	2416585	10	21	RLSAQVDNAYW	TCCGCTCAGGTGGACAACGCGTACTGGCTGTGG
ZNF814-EIF3B	chr19	58400135	chr7	2416585	11	20	LSAQVDNAY	GCTCAGGTGGACAACGCGTACTGGCTG
ZNF814-EIF3B	chr19	58400135	chr7	2416585	11	21	LSAQVDNAYW	GCTCAGGTGGACAACGCGTACTGGCTGTGG
ZNF814-EIF3B	chr19	58400135	chr7	2416585	12	21	SAQVDNAYW	CAGGTGGACAACGCGTACTGGCTGTGG
ZNF814-EIF3B	chr19	58400135	chr7	2416585	12	23	SAQVDNAYWLW	CAGGTGGACAACGCGTACTGGCTGTGGACTTTC
ZNF814-EIF3B	chr19	58400135	chr7	2416585	7	16	ATLRLSAQV	CTGAGGCTCTCCGCTCAGGTGGACAAC
ZNF814-EIF3B	chr19	58400135	chr7	2416585	9	20	LRLSAQVDNAY	CTCTCCGCTCAGGTGGACAACGCGTACTGGCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ZNF814-EIF3B	chr19	58400135	chr7	2416585	0	15	RGSMAAAATLRLSAQ	TCGATGGCTGCCGCGGCTACGCTGAGGCTCTCCGCTCAGGTGGAC

Top

Information of the samples that have these potential fusion neoantigens of ZNF814-EIF3B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	ZNF814-EIF3B	chr19	58400135	ENST00000435989	chr7	2416585	ENST00000360876	TCGA-FS-A1ZK-06A

Top

Potential target of CAR-T therapy development for ZNF814-EIF3B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF814-EIF3B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF814-EIF3B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)