Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF91-ASF1B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF91-ASF1B
	FusionPDB ID: 103099
	FusionGDB2.0 ID: 103099
		Hgene	Tgene
	Gene symbol	ZNF91	ASF1B
	Gene ID	7644	55723
	Gene name	zinc finger protein 91	anti-silencing function 1B histone chaperone
	Synonyms	HPF7\|HTF10	CIA-II
	Cytomap	19p12	19p13.12
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 91zinc finger protein 91 (HPF7, HTF10)zinc finger protein HPF7zinc finger protein HTF10	histone chaperone ASF1BASF1 anti-silencing function 1 homolog BCCG1-interacting factor A-IIanti-silencing function protein 1 homolog BhAsf1hAsf1bhCIA-II
	Modification date	20200313	20200313
	UniProtAcc	.	Q9NVP2 Main function of 5'-partner protein: FUNCTION: Histone chaperone that facilitates histone deposition and histone exchange and removal during nucleosome assembly and disassembly. Cooperates with chromatin assembly factor 1 (CAF-1) to promote replication-dependent chromatin assembly. Does not participate in replication-independent nucleosome deposition which is mediated by ASF1A and HIRA. Required for spermatogenesis. {ECO:0000269\|PubMed:11897662, ECO:0000269\|PubMed:12842904, ECO:0000269\|PubMed:14718166, ECO:0000269\|PubMed:15664198, ECO:0000269\|PubMed:16151251}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000300619, ENST00000397082, ENST00000599743, ENST00000596528,	ENST00000474890, ENST00000592798, ENST00000263382,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 8 X 7=616	7 X 5 X 6=210
	# samples	11	8
	** MAII score	log2(11/616*10)=-2.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/210*10)=-1.39231742277876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF91 [Title/Abstract] AND ASF1B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF91 [Title/Abstract] AND ASF1B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF91(23578127)-ASF1B(14232520), # samples:3
Anticipated loss of major functional domain due to fusion event.	ZNF91-ASF1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF91-ASF1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ZNF91	GO:0045892	negative regulation of transcription, DNA-templated	25274305
Hgene	ZNF91	GO:0070895	negative regulation of transposon integration	25274305
Tgene	ASF1B	GO:0006335	DNA replication-dependent nucleosome assembly	14718166
Tgene	ASF1B	GO:0006336	DNA replication-independent nucleosome assembly	14718166

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:23578127/chr19:14232520)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF91 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ASF1B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000599743	ZNF91	chr19	23578127	-	ENST00000263382	ASF1B	chr19	14232520	-	1467	133	25	516	163
ENST00000300619	ZNF91	chr19	23578127	-	ENST00000263382	ASF1B	chr19	14232520	-	1570	236	20	619	199
ENST00000397082	ZNF91	chr19	23578127	-	ENST00000263382	ASF1B	chr19	14232520	-	1456	122	14	505	163

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000599743	ENST00000263382	ZNF91	chr19	23578127	-	ASF1B	chr19	14232520	-	0.017630534	0.9823695
ENST00000300619	ENST00000263382	ZNF91	chr19	23578127	-	ASF1B	chr19	14232520	-	0.013316801	0.9866832
ENST00000397082	ENST00000263382	ZNF91	chr19	23578127	-	ASF1B	chr19	14232520	-	0.0188489	0.98115104

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF91-ASF1B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF91	chr19	23578127	ASF1B	chr19	14232520	122	36	TAKMPGTPGSLEMADAPNPSLIPETD
ZNF91	chr19	23578127	ASF1B	chr19	14232520	133	36	TAKMPGTPGSLEMADAPNPSLIPETD
ZNF91	chr19	23578127	ASF1B	chr19	14232520	236	72	TAKMPGTPGSLEMADAPNPSLIPETD

Top

Potential FusionNeoAntigen Information of ZNF91-ASF1B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF91-ASF1B_23578127_14232520.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:03	MADAPNPSL	0.9946	0.9282	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B15:10	MADAPNPSL	0.9911	0.5246	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:04	MADAPNPSL	0.9835	0.9684	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:02	MADAPNPSL	0.9835	0.9684	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:08	MADAPNPSL	0.9827	0.9241	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B15:37	MADAPNPSL	0.9775	0.5341	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:01	MADAPNPSL	0.9701	0.9372	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:01	MADAPNPSL	0.9613	0.9361	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B45:01	LEMADAPNP	0.9343	0.9121	10	19
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-A02:21	MADAPNPSL	0.9288	0.6601	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:13	MADAPNPSL	0.9274	0.9339	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:05	MADAPNPSL	0.9017	0.676	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-A02:35	MADAPNPSL	0.8775	0.546	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B50:02	LEMADAPNP	0.7625	0.7497	10	19
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B50:01	LEMADAPNP	0.4015	0.777	10	19
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B41:01	LEMADAPNP	0.2811	0.9259	10	19
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:04	EMADAPNPSL	0.7743	0.9128	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:02	EMADAPNPSL	0.7743	0.9128	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:13	LEMADAPNPSL	0.9975	0.9464	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:15	MADAPNPSL	1	0.9536	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:07	MADAPNPSL	1	0.7613	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:09	MADAPNPSL	1	0.9376	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:10	MADAPNPSL	1	0.739	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C01:17	MADAPNPSL	0.9999	0.9539	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:07	MADAPNPSL	0.9998	0.9762	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:19	MADAPNPSL	0.9998	0.9836	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:08	MADAPNPSL	0.9997	0.8782	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C15:06	MADAPNPSL	0.9997	0.9214	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C15:04	MADAPNPSL	0.9996	0.899	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:06	MADAPNPSL	0.9995	0.8361	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C01:30	MADAPNPSL	0.9993	0.9411	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:04	MADAPNPSL	0.9991	0.9458	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:13	MADAPNPSL	0.9991	0.9458	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:03	MADAPNPSL	0.9974	0.9712	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:14	MADAPNPSL	0.9935	0.8054	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:14	MADAPNPSL	0.9918	0.9757	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:08	MADAPNPSL	0.9898	0.8339	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:09	MADAPNPSL	0.9854	0.6	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:12	MADAPNPSL	0.9835	0.9684	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C07:13	MADAPNPSL	0.9794	0.8886	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C02:06	MADAPNPSL	0.9724	0.9522	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:10	MADAPNPSL	0.9672	0.93	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C06:03	MADAPNPSL	0.9641	0.988	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B14:03	MADAPNPSL	0.9609	0.7624	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C07:29	MADAPNPSL	0.9563	0.9287	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B15:21	MADAPNPSL	0.9489	0.9275	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-A02:07	MADAPNPSL	0.9345	0.5452	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C12:12	MADAPNPSL	0.9162	0.9489	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:05	MADAPNPSL	0.903	0.9311	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B78:01	MADAPNPSL	0.8838	0.5079	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B51:07	MADAPNPSL	0.8784	0.7416	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B07:12	MADAPNPSL	0.7991	0.5348	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B42:02	MADAPNPSL	0.3865	0.5763	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B42:01	MADAPNPSL	0.3634	0.5687	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:09	MADAPNPSLI	1	0.9044	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:15	MADAPNPSLI	0.9999	0.9435	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:09	EMADAPNPSL	0.9997	0.9153	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:15	EMADAPNPSL	0.9994	0.9548	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:06	MADAPNPSLI	0.9979	0.8175	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:13	MADAPNPSLI	0.9846	0.9327	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:04	MADAPNPSLI	0.9846	0.9327	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:03	MADAPNPSLI	0.8572	0.9685	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:12	EMADAPNPSL	0.7743	0.9128	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:15	LEMADAPNPSL	1	0.9718	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:09	LEMADAPNPSL	1	0.9424	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:03	LEMADAPNPSL	0.9998	0.9753	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:08	LEMADAPNPSL	0.9991	0.9066	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:03	MADAPNPSL	1	0.8199	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C18:01	MADAPNPSL	1	0.779	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:02	MADAPNPSL	1	0.9536	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:01	MADAPNPSL	1	0.9376	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:01	MADAPNPSL	1	0.7613	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C01:03	MADAPNPSL	0.9999	0.9184	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C01:02	MADAPNPSL	0.9999	0.9521	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:03	MADAPNPSL	0.9998	0.987	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:04	MADAPNPSL	0.9998	0.987	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C06:06	MADAPNPSL	0.9998	0.9846	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:67	MADAPNPSL	0.9997	0.9784	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C15:05	MADAPNPSL	0.9996	0.8789	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C15:09	MADAPNPSL	0.9996	0.899	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:05	MADAPNPSL	0.9995	0.9105	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C15:02	MADAPNPSL	0.9995	0.8604	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:17	MADAPNPSL	0.9994	0.9739	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:04	MADAPNPSL	0.9993	0.8239	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:06	MADAPNPSL	0.9991	0.9899	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:02	MADAPNPSL	0.9988	0.9707	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:01	MADAPNPSL	0.9974	0.9712	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:13	MADAPNPSL	0.995	0.9305	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C16:01	MADAPNPSL	0.9929	0.9773	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C16:02	MADAPNPSL	0.9899	0.9894	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C16:04	MADAPNPSL	0.9886	0.9798	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:11	MADAPNPSL	0.9854	0.8332	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:09	MADAPNPSL	0.9835	0.9684	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:02	MADAPNPSL	0.9708	0.9327	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B67:01	MADAPNPSL	0.9708	0.82	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:77	MADAPNPSL	0.9701	0.9372	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B39:31	MADAPNPSL	0.9679	0.9374	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:23	MADAPNPSL	0.9679	0.9343	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C07:04	MADAPNPSL	0.9623	0.9089	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:11	MADAPNPSL	0.9574	0.928	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C17:01	MADAPNPSL	0.9547	0.9356	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B15:09	MADAPNPSL	0.9425	0.7717	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-A02:14	MADAPNPSL	0.934	0.5642	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C12:03	MADAPNPSL	0.9332	0.9712	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C02:10	MADAPNPSL	0.929	0.9656	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C02:02	MADAPNPSL	0.929	0.9656	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-A02:06	MADAPNPSL	0.9288	0.6601	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:17	MADAPNPSL	0.9002	0.8524	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:30	MADAPNPSL	0.9002	0.8524	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B78:02	MADAPNPSL	0.896	0.6229	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B07:13	MADAPNPSL	0.8609	0.8174	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B57:02	MADAPNPSL	0.8543	0.8861	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C12:02	MADAPNPSL	0.8532	0.9578	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-A69:01	MADAPNPSL	0.8022	0.6812	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:24	MADAPNPSL	0.7867	0.9197	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B08:12	MADAPNPSL	0.5901	0.7784	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B50:04	LEMADAPNP	0.4015	0.777	10	19
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B50:05	LEMADAPNP	0.4015	0.777	10	19
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B15:30	MADAPNPSL	0.3921	0.8923	12	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C04:03	MADAPNPSLI	1	0.7824	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:01	MADAPNPSLI	1	0.9044	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:02	MADAPNPSLI	0.9999	0.9435	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:01	EMADAPNPSL	0.9997	0.9153	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:02	EMADAPNPSL	0.9994	0.9548	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C03:06	MADAPNPSLI	0.9882	0.9896	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:01	MADAPNPSLI	0.8572	0.9685	12	22
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-A69:01	EMADAPNPSL	0.8323	0.5395	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B35:09	EMADAPNPSL	0.7743	0.9128	11	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C05:01	LEMADAPNPSL	1	0.9424	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:02	LEMADAPNPSL	1	0.9718	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B40:04	LEMADAPNPSL	0.9999	0.7779	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-C08:01	LEMADAPNPSL	0.9998	0.9753	10	21
ZNF91-ASF1B	chr19	23578127	chr19	14232520	236	HLA-B41:03	LEMADAPNPSL	0.9975	0.7578	10	21

Top

Potential FusionNeoAntigen Information of ZNF91-ASF1B in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ZNF91-ASF1B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9539	TPGSLEMADAPNPS	ZNF91	ASF1B	chr19	23578127	chr19	14232520	236

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF91-ASF1B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9539	TPGSLEMADAPNPS	-7.15543	-7.26883
HLA-B14:02	3BVN	9539	TPGSLEMADAPNPS	-4.77435	-5.80965
HLA-B52:01	3W39	9539	TPGSLEMADAPNPS	-6.80875	-6.92215
HLA-B52:01	3W39	9539	TPGSLEMADAPNPS	-4.20386	-5.23916
HLA-A11:01	4UQ2	9539	TPGSLEMADAPNPS	-7.5194	-8.5547
HLA-A11:01	4UQ2	9539	TPGSLEMADAPNPS	-6.9601	-7.0735
HLA-A24:02	5HGA	9539	TPGSLEMADAPNPS	-7.52403	-7.63743
HLA-A24:02	5HGA	9539	TPGSLEMADAPNPS	-5.82433	-6.85963
HLA-B27:05	6PYJ	9539	TPGSLEMADAPNPS	-3.28285	-4.31815
HLA-B44:05	3DX8	9539	TPGSLEMADAPNPS	-5.91172	-6.94702
HLA-B44:05	3DX8	9539	TPGSLEMADAPNPS	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ZNF91-ASF1B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF91-ASF1B	chr19	23578127	chr19	14232520	10	19	LEMADAPNP	CTAGAAATGGCCGACGCCCCCAACCCA
ZNF91-ASF1B	chr19	23578127	chr19	14232520	10	21	LEMADAPNPSL	CTAGAAATGGCCGACGCCCCCAACCCATCCCTC
ZNF91-ASF1B	chr19	23578127	chr19	14232520	11	21	EMADAPNPSL	GAAATGGCCGACGCCCCCAACCCATCCCTC
ZNF91-ASF1B	chr19	23578127	chr19	14232520	12	21	MADAPNPSL	ATGGCCGACGCCCCCAACCCATCCCTC
ZNF91-ASF1B	chr19	23578127	chr19	14232520	12	22	MADAPNPSLI	ATGGCCGACGCCCCCAACCCATCCCTCATC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ZNF91-ASF1B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PCPG	ZNF91-ASF1B	chr19	23578127	ENST00000300619	chr19	14232520	ENST00000263382	TCGA-S7-A7WP-01A

Top

Potential target of CAR-T therapy development for ZNF91-ASF1B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF91-ASF1B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF91-ASF1B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)