Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:C11orf30-UVRAG

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: C11orf30-UVRAG
	FusionPDB ID: 10700
	FusionGDB2.0 ID: 10700
		Hgene	Tgene
	Gene symbol	C11orf30	UVRAG
	Gene ID	56946	7405
	Gene name	EMSY transcriptional repressor, BRCA2 interacting	UV radiation resistance associated
	Synonyms	C11orf30\|GL002	DHTX\|VPS38\|p63
	Cytomap	11q13.5	11q13.5
	Type of gene	protein-coding	protein-coding
	Description	BRCA2-interacting transcriptional repressor EMSYEMSY, BRCA2 interacting transcriptional repressorprotein EMSY	UV radiation resistance-associated gene proteinbeclin 1 binding proteindisrupted in heterotaxy
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000334736, ENST00000343878, ENST00000524767, ENST00000525038, ENST00000525919, ENST00000529032, ENST00000533248, ENST00000524490, ENST00000525959, ENST00000533988,	ENST00000531818, ENST00000532130, ENST00000533454, ENST00000539288, ENST00000525872, ENST00000538870, ENST00000356136, ENST00000528420,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 10 X 4=360	28 X 21 X 11=6468
	# samples	14	36
	** MAII score	log2(14/360*10)=-1.36257007938471 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(36/6468*10)=-4.16725086714399 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: C11orf30 [Title/Abstract] AND UVRAG [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: C11orf30 [Title/Abstract] AND UVRAG [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	C11orf30(76207513)-UVRAG(75715049), # samples:2 C11orf30(76253411)-UVRAG(75851755), # samples:2 UVRAG(75776832)-C11orf30(76239311), # samples:1 UVRAG(75776832)-C11orf30(76239312), # samples:1
Anticipated loss of major functional domain due to fusion event.	C11orf30-UVRAG seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C11orf30-UVRAG seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C11orf30-UVRAG seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. C11orf30-UVRAG seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. C11orf30-UVRAG seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. C11orf30-UVRAG seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. C11orf30-UVRAG seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	UVRAG	GO:0071900	regulation of protein serine/threonine kinase activity	22542840
Tgene	UVRAG	GO:0097352	autophagosome maturation	28306502
Tgene	UVRAG	GO:0097680	double-strand break repair via classical nonhomologous end joining	22542840

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:76207513/chr11:75715049)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across C11orf30 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across UVRAG (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000334736	C11orf30	chr11	76207513	+	ENST00000356136	UVRAG	chr11	75715049	+	4562	1506	143	2779	878
ENST00000334736	C11orf30	chr11	76207513	+	ENST00000528420	UVRAG	chr11	75715049	+	3161	1506	143	2779	878
ENST00000343878	C11orf30	chr11	76207513	+	ENST00000356136	UVRAG	chr11	75715049	+	4562	1506	143	2779	878
ENST00000343878	C11orf30	chr11	76207513	+	ENST00000528420	UVRAG	chr11	75715049	+	3161	1506	143	2779	878
ENST00000533248	C11orf30	chr11	76207513	+	ENST00000356136	UVRAG	chr11	75715049	+	4500	1444	39	2717	892
ENST00000533248	C11orf30	chr11	76207513	+	ENST00000528420	UVRAG	chr11	75715049	+	3099	1444	39	2717	892
ENST00000525919	C11orf30	chr11	76207513	+	ENST00000356136	UVRAG	chr11	75715049	+	4461	1405	39	2678	879
ENST00000525919	C11orf30	chr11	76207513	+	ENST00000528420	UVRAG	chr11	75715049	+	3060	1405	39	2678	879
ENST00000524767	C11orf30	chr11	76207513	+	ENST00000356136	UVRAG	chr11	75715049	+	4503	1447	39	2720	893
ENST00000524767	C11orf30	chr11	76207513	+	ENST00000528420	UVRAG	chr11	75715049	+	3102	1447	39	2720	893
ENST00000525038	C11orf30	chr11	76207513	+	ENST00000356136	UVRAG	chr11	75715049	+	4503	1447	39	2720	893
ENST00000525038	C11orf30	chr11	76207513	+	ENST00000528420	UVRAG	chr11	75715049	+	3102	1447	39	2720	893
ENST00000529032	C11orf30	chr11	76207513	+	ENST00000356136	UVRAG	chr11	75715049	+	4419	1363	0	2636	878
ENST00000529032	C11orf30	chr11	76207513	+	ENST00000528420	UVRAG	chr11	75715049	+	3018	1363	0	2636	878
ENST00000524490	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	5043	2558	143	2560	805
ENST00000524490	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3642	2558	143	2560	805
ENST00000524490	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3348	2558	143	2560	805
ENST00000524490	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3348	2558	143	2560	805
ENST00000334736	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	5337	2852	143	2854	903
ENST00000334736	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3936	2852	143	2854	903
ENST00000334736	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3642	2852	143	2854	903
ENST00000334736	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3642	2852	143	2854	903
ENST00000343878	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	5337	2852	143	2854	903
ENST00000343878	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3936	2852	143	2854	903
ENST00000343878	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3642	2852	143	2854	903
ENST00000343878	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3642	2852	143	2854	903
ENST00000533248	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	4960	2475	39	2477	812
ENST00000533248	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3559	2475	39	2477	812
ENST00000533248	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3265	2475	39	2477	812
ENST00000533248	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3265	2475	39	2477	812
ENST00000525919	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	5236	2751	39	2753	904
ENST00000525919	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3835	2751	39	2753	904
ENST00000525919	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3541	2751	39	2753	904
ENST00000525919	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3541	2751	39	2753	904
ENST00000524767	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	5278	2793	39	2795	918
ENST00000524767	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3877	2793	39	2795	918
ENST00000524767	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3583	2793	39	2795	918
ENST00000524767	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3583	2793	39	2795	918
ENST00000525038	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	5236	2751	39	2753	904
ENST00000525038	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3835	2751	39	2753	904
ENST00000525038	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3541	2751	39	2753	904
ENST00000525038	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3541	2751	39	2753	904
ENST00000529032	C11orf30	chr11	76253411	+	ENST00000356136	UVRAG	chr11	75851755	+	5194	2709	0	2711	903
ENST00000529032	C11orf30	chr11	76253411	+	ENST00000528420	UVRAG	chr11	75851755	+	3793	2709	0	2711	903
ENST00000529032	C11orf30	chr11	76253411	+	ENST00000533454	UVRAG	chr11	75851755	+	3499	2709	0	2711	903
ENST00000529032	C11orf30	chr11	76253411	+	ENST00000539288	UVRAG	chr11	75851755	+	3499	2709	0	2711	903

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000334736	ENST00000356136	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.001526834	0.9984731
ENST00000334736	ENST00000528420	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.003671792	0.9963282
ENST00000343878	ENST00000356136	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.001526834	0.9984731
ENST00000343878	ENST00000528420	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.003671792	0.9963282
ENST00000533248	ENST00000356136	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.001516416	0.9984836
ENST00000533248	ENST00000528420	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.003940496	0.99605954
ENST00000525919	ENST00000356136	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.001653885	0.9983461
ENST00000525919	ENST00000528420	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.004276842	0.9957231
ENST00000524767	ENST00000356136	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.001540933	0.9984591
ENST00000524767	ENST00000528420	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.0039873	0.9960127
ENST00000525038	ENST00000356136	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.001540933	0.9984591
ENST00000525038	ENST00000528420	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.0039873	0.9960127
ENST00000529032	ENST00000356136	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.001470904	0.9985291
ENST00000529032	ENST00000528420	C11orf30	chr11	76207513	+	UVRAG	chr11	75715049	+	0.003796619	0.99620336
ENST00000524490	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.002037998	0.997962
ENST00000524490	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.00386079	0.9961392
ENST00000524490	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.005594523	0.9944055
ENST00000524490	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.005594523	0.9944055
ENST00000334736	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.001350731	0.9986493
ENST00000334736	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.002723068	0.99727696
ENST00000334736	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.00368845	0.9963115
ENST00000334736	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.00368845	0.9963115
ENST00000343878	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.001350731	0.9986493
ENST00000343878	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.002723068	0.99727696
ENST00000343878	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.00368845	0.9963115
ENST00000343878	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.00368845	0.9963115
ENST00000533248	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.002681823	0.9973182
ENST00000533248	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.005692926	0.9943071
ENST00000533248	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.008116107	0.9918839
ENST00000533248	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.008116107	0.9918839
ENST00000525919	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.001374235	0.99862576
ENST00000525919	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.002931886	0.9970681
ENST00000525919	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.003982266	0.99601775
ENST00000525919	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.003982266	0.99601775
ENST00000524767	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.001616467	0.9983835
ENST00000524767	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.003319725	0.99668026
ENST00000524767	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.004507747	0.9954922
ENST00000524767	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.004507747	0.9954922
ENST00000525038	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.001761923	0.9982381
ENST00000525038	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.003679582	0.99632037
ENST00000525038	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.004978924	0.9950211
ENST00000525038	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.004978924	0.9950211
ENST00000529032	ENST00000356136	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.001329276	0.9986707
ENST00000529032	ENST00000528420	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.002792103	0.99720794
ENST00000529032	ENST00000533454	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.003778603	0.9962214
ENST00000529032	ENST00000539288	C11orf30	chr11	76253411	+	UVRAG	chr11	75851755	+	0.003778603	0.9962214

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for C11orf30-UVRAG

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
C11orf30	chr11	76207513	UVRAG	chr11	75715049	1363	454	PGIKPTIQIKQESGSAFSAEHLKLQL
C11orf30	chr11	76207513	UVRAG	chr11	75715049	1405	455	PGIKPTIQIKQESGSAFSAEHLKLQL
C11orf30	chr11	76207513	UVRAG	chr11	75715049	1444	468	PGIKPTIQIKQESGSAFSAEHLKLQL
C11orf30	chr11	76207513	UVRAG	chr11	75715049	1447	469	PGIKPTIQIKQESGSAFSAEHLKLQL
C11orf30	chr11	76207513	UVRAG	chr11	75715049	1506	454	PGIKPTIQIKQESGSAFSAEHLKLQL

Top

Potential FusionNeoAntigen Information of C11orf30-UVRAG in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

C11orf30-UVRAG_76207513_75715049.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:03	KQESGSAF	0.9434	0.8485	9	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B45:01	QESGSAFSA	0.9974	0.9853	10	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B50:02	QESGSAFSA	0.9933	0.8789	10	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B41:01	QESGSAFSA	0.6575	0.9523	10	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:10	IKQESGSAF	0.5253	0.5639	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:03	IKQESGSAF	0.512	0.7117	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:18	IKQESGSAF	0.498	0.6694	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B50:01	QESGSAFSA	0.4975	0.9484	10	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:37	IKQESGSAF	0.3055	0.6083	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:01	QIKQESGSAF	0.9998	0.932	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:02	QIKQESGSAF	0.9904	0.9647	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:25	QIKQESGSAF	0.9898	0.9561	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:03	QIKQESGSAF	0.984	0.8949	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B45:01	KQESGSAFSA	0.9171	0.9835	9	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B50:01	KQESGSAFSA	0.6003	0.9098	9	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B41:01	KQESGSAFSA	0.5465	0.9569	9	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:01	IQIKQESGSAF	1	0.8263	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:25	IQIKQESGSAF	0.9793	0.8682	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:03	IQIKQESGSAF	0.9766	0.7483	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B13:01	IQIKQESGSAF	0.9331	0.9863	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B40:06	QESGSAFSA	0.9919	0.8055	10	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:21	IKQESGSAF	0.4277	0.847	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:07	QIKQESGSAF	0.9996	0.894	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B40:06	KQESGSAFSA	0.9829	0.8326	9	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:07	IQIKQESGSAF	0.9992	0.7711	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:04	IQIKQESGSAF	0.9988	0.8348	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:05	IQIKQESGSAF	0.8968	0.7511	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:50	KQESGSAF	0.9962	0.8693	9	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:53	KQESGSAF	0.9945	0.8602	9	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:54	KQESGSAF	0.9942	0.8349	9	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:68	KQESGSAF	0.9812	0.6857	9	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B48:02	KQESGSAF	0.6832	0.9073	9	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B50:04	QESGSAFSA	0.4975	0.9484	10	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B50:05	QESGSAFSA	0.4975	0.9484	10	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B48:02	IKQESGSAF	0.4086	0.8481	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:68	IKQESGSAF	0.3629	0.6551	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:54	IKQESGSAF	0.3561	0.7311	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:53	IKQESGSAF	0.2902	0.7488	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:09	IKQESGSAF	0.2372	0.7117	8	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:08	QIKQESGSAF	0.9998	0.9019	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:33	QIKQESGSAF	0.9998	0.932	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:125	QIKQESGSAF	0.9998	0.932	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:11	QIKQESGSAF	0.9998	0.9101	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:34	QIKQESGSAF	0.9998	0.932	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:27	QIKQESGSAF	0.9998	0.943	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:135	QIKQESGSAF	0.9998	0.9324	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:54	QIKQESGSAF	0.9997	0.912	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:35	QIKQESGSAF	0.9997	0.9544	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:50	QIKQESGSAF	0.9995	0.9578	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:39	QIKQESGSAF	0.9902	0.9222	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:12	QIKQESGSAF	0.988	0.8878	7	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B50:05	KQESGSAFSA	0.6003	0.9098	9	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B50:04	KQESGSAFSA	0.6003	0.9098	9	19
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:34	IQIKQESGSAF	1	0.8263	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:135	IQIKQESGSAF	1	0.8212	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:125	IQIKQESGSAF	1	0.8263	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:33	IQIKQESGSAF	1	0.8263	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:27	IQIKQESGSAF	1	0.8882	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:54	IQIKQESGSAF	0.9999	0.7885	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:53	IQIKQESGSAF	0.9999	0.8169	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:24	IQIKQESGSAF	0.9999	0.9095	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:50	IQIKQESGSAF	0.9998	0.9502	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:68	IQIKQESGSAF	0.9993	0.7124	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:35	IQIKQESGSAF	0.9989	0.8664	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:73	IQIKQESGSAF	0.9989	0.9606	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:30	IQIKQESGSAF	0.9984	0.9368	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:12	IQIKQESGSAF	0.9968	0.8066	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:39	IQIKQESGSAF	0.9877	0.8014	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B15:20	IQIKQESGSAF	0.8965	0.8156	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B35:28	IQIKQESGSAF	0.8838	0.8308	6	17
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	HLA-B48:02	IQIKQESGSAF	0.8586	0.7973	6	17

Top

Potential FusionNeoAntigen Information of C11orf30-UVRAG in HLA II

C11orf30-UVRAG_76207513_75715049.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	DRB1-0804	KPTIQIKQESGSAFS	3	18
C11orf30-UVRAG	chr11	76207513	chr11	75715049	1506	DRB1-1415	KPTIQIKQESGSAFS	3	18

Top

Fusion breakpoint peptide structures of C11orf30-UVRAG

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3915	IQIKQESGSAFSAE	C11orf30	UVRAG	chr11	76207513	chr11	75715049	1506

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of C11orf30-UVRAG

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3915	IQIKQESGSAFSAE	-7.15543	-7.26883
HLA-B14:02	3BVN	3915	IQIKQESGSAFSAE	-4.77435	-5.80965
HLA-B52:01	3W39	3915	IQIKQESGSAFSAE	-6.80875	-6.92215
HLA-B52:01	3W39	3915	IQIKQESGSAFSAE	-4.20386	-5.23916
HLA-A11:01	4UQ2	3915	IQIKQESGSAFSAE	-7.5194	-8.5547
HLA-A11:01	4UQ2	3915	IQIKQESGSAFSAE	-6.9601	-7.0735
HLA-A24:02	5HGA	3915	IQIKQESGSAFSAE	-7.52403	-7.63743
HLA-A24:02	5HGA	3915	IQIKQESGSAFSAE	-5.82433	-6.85963
HLA-B27:05	6PYJ	3915	IQIKQESGSAFSAE	-3.28285	-4.31815
HLA-B44:05	3DX8	3915	IQIKQESGSAFSAE	-5.91172	-6.94702
HLA-B44:05	3DX8	3915	IQIKQESGSAFSAE	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of C11orf30-UVRAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
C11orf30-UVRAG	chr11	76207513	chr11	75715049	10	19	QESGSAFSA	AGGAGTCAGGAAGTGCATTTTCAGCTG
C11orf30-UVRAG	chr11	76207513	chr11	75715049	6	17	IQIKQESGSAF	TCCAAATCAAACAGGAGTCAGGAAGTGCATTTT
C11orf30-UVRAG	chr11	76207513	chr11	75715049	7	17	QIKQESGSAF	AAATCAAACAGGAGTCAGGAAGTGCATTTT
C11orf30-UVRAG	chr11	76207513	chr11	75715049	8	17	IKQESGSAF	TCAAACAGGAGTCAGGAAGTGCATTTT
C11orf30-UVRAG	chr11	76207513	chr11	75715049	9	17	KQESGSAF	AACAGGAGTCAGGAAGTGCATTTT
C11orf30-UVRAG	chr11	76207513	chr11	75715049	9	19	KQESGSAFSA	AACAGGAGTCAGGAAGTGCATTTTCAGCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
C11orf30-UVRAG	chr11	76207513	chr11	75715049	3	18	KPTIQIKQESGSAFS	AACCTACCATCCAAATCAAACAGGAGTCAGGAAGTGCATTTTCAG

Top

Information of the samples that have these potential fusion neoantigens of C11orf30-UVRAG

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	C11orf30-UVRAG	chr11	76207513	ENST00000334736	chr11	75715049	ENST00000356136	TCGA-A2-A0ES-01A

Top

Potential target of CAR-T therapy development for C11orf30-UVRAG

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to C11orf30-UVRAG

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to C11orf30-UVRAG

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)