Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:C19orf25-KLF2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: C19orf25-KLF2
	FusionPDB ID: 11171
	FusionGDB2.0 ID: 11171
		Hgene	Tgene
	Gene symbol	C19orf25	KLF2
	Gene ID	148223	10365
	Gene name	chromosome 19 open reading frame 25	Kruppel like factor 2
	Synonyms	-	LKLF
	Cytomap	19p13.3	19p13.11
	Type of gene	protein-coding	protein-coding
	Description	UPF0449 protein C19orf25	Krueppel-like factor 2Kruppel-like factor 2 (lung)Kruppel-like factor LKLFlung Kruppel-like factorlung Kruppel-like zinc finger transcription factorlung krueppel-like factor
	Modification date	20200313	20200313
	UniProtAcc	Q9UFG5 Main function of 5'-partner protein:	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000591027, ENST00000436106, ENST00000585675, ENST00000588427, ENST00000588871, ENST00000586564, ENST00000588849, ENST00000592872, ENST00000427685,	ENST00000248071, ENST00000592003,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 4 X 9=360	3 X 3 X 2=18
	# samples	12	4
	** MAII score	log2(12/360*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/18*10)=1.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: C19orf25 [Title/Abstract] AND KLF2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: C19orf25 [Title/Abstract] AND KLF2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	C19orf25(1478771)-KLF2(16437665), # samples:1
Anticipated loss of major functional domain due to fusion event.	C19orf25-KLF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C19orf25-KLF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C19orf25-KLF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. C19orf25-KLF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. C19orf25-KLF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. C19orf25-KLF2 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	KLF2	GO:0000122	negative regulation of transcription by RNA polymerase II	26299712
Tgene	KLF2	GO:0045429	positive regulation of nitric oxide biosynthetic process	21768538
Tgene	KLF2	GO:0045893	positive regulation of transcription, DNA-templated	21063504
Tgene	KLF2	GO:0048386	positive regulation of retinoic acid receptor signaling pathway	26416422

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:1478771/chr19:16437665)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across C19orf25 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across KLF2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000588849	C19orf25	chr19	1478771	-	ENST00000248071	KLF2	chr19	16437665	+	1162	143	808	206	200
ENST00000588849	C19orf25	chr19	1478771	-	ENST00000592003	KLF2	chr19	16437665	+	548	143	13	318	101
ENST00000586564	C19orf25	chr19	1478771	-	ENST00000248071	KLF2	chr19	16437665	+	1364	345	1010	408	200
ENST00000586564	C19orf25	chr19	1478771	-	ENST00000592003	KLF2	chr19	16437665	+	750	345	6	506	166
ENST00000592872	C19orf25	chr19	1478771	-	ENST00000248071	KLF2	chr19	16437665	+	1221	202	867	265	200
ENST00000592872	C19orf25	chr19	1478771	-	ENST00000592003	KLF2	chr19	16437665	+	607	202	72	377	101

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000588849	ENST00000248071	C19orf25	chr19	1478771	-	KLF2	chr19	16437665	+	0.7363426	0.26365736
ENST00000588849	ENST00000592003	C19orf25	chr19	1478771	-	KLF2	chr19	16437665	+	0.28106523	0.7189348
ENST00000586564	ENST00000248071	C19orf25	chr19	1478771	-	KLF2	chr19	16437665	+	0.76719224	0.23280777
ENST00000586564	ENST00000592003	C19orf25	chr19	1478771	-	KLF2	chr19	16437665	+	0.7002895	0.2997105
ENST00000592872	ENST00000248071	C19orf25	chr19	1478771	-	KLF2	chr19	16437665	+	0.77033716	0.22966282
ENST00000592872	ENST00000592003	C19orf25	chr19	1478771	-	KLF2	chr19	16437665	+	0.34857318	0.6514268

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for C19orf25-KLF2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
C19orf25	chr19	1478771	KLF2	chr19	16437665	143	36	LEDVRGAPAEDPVFTILAPEGEKPYH
C19orf25	chr19	1478771	KLF2	chr19	16437665	202	36	LEDVRGAPAEDPVFTILAPEGEKPYH
C19orf25	chr19	1478771	KLF2	chr19	16437665	345	113	RQRIQCSPSWPRKVRSPTTATGTAAA

Top

Potential FusionNeoAntigen Information of C19orf25-KLF2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

C19orf25-KLF2_1478771_16437665.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	HLA-A30:08	KVRSPTTAT	0.9808	0.7118	12	21
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	HLA-A30:08	KVRSPTTATG	0.9731	0.534	12	22
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	HLA-B54:01	WPRKVRSPTTA	0.9941	0.5294	9	20
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	HLA-A30:01	KVRSPTTA	0.9845	0.8438	12	20
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	HLA-A30:01	KVRSPTTAT	0.9804	0.8393	12	21
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	HLA-B07:09	SPSWPRKVR	0.9688	0.6627	6	15

Top

Potential FusionNeoAntigen Information of C19orf25-KLF2 in HLA II

C19orf25-KLF2_1478771_16437665.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0405	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0405	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0409	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0409	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0417	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0417	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0424	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0424	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0429	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0429	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0430	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0430	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0445	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0445	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0447	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0447	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0448	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0448	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0454	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0457	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0457	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0462	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0462	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0464	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0477	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0477	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0480	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0480	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0480	AEDPVFTILAPEGEK	8	23
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0482	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0482	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0483	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0483	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0484	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0484	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0486	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0486	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0487	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0487	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0489	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0489	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0805	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0805	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0818	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0818	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0832	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0832	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-0832	AEDPVFTILAPEGEK	8	23
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1001	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1001	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1001	AEDPVFTILAPEGEK	8	23
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1001	PVFTILAPEGEKPYH	11	26
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1002	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1002	AEDPVFTILAPEGEK	8	23
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1002	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1003	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1003	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1003	AEDPVFTILAPEGEK	8	23
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1003	PVFTILAPEGEKPYH	11	26
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1216	EDPVFTILAPEGEKP	9	24
C19orf25-KLF2	chr19	1478771	chr19	16437665	143	DRB1-1216	DPVFTILAPEGEKPY	10	25
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	DRB5-0106	RQRIQCSPSWPRKVR	0	15
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	DRB5-0111	RQRIQCSPSWPRKVR	0	15
C19orf25-KLF2	chr19	1478771	chr19	16437665	345	DRB5-0205	RQRIQCSPSWPRKVR	0	15

Top

Fusion breakpoint peptide structures of C19orf25-KLF2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8901	SPSWPRKVRSPTTA	C19orf25	KLF2	chr19	1478771	chr19	16437665	345

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of C19orf25-KLF2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8901	SPSWPRKVRSPTTA	-7.9962	-8.1096
HLA-B14:02	3BVN	8901	SPSWPRKVRSPTTA	-5.70842	-6.74372
HLA-B52:01	3W39	8901	SPSWPRKVRSPTTA	-6.83737	-6.95077
HLA-B52:01	3W39	8901	SPSWPRKVRSPTTA	-4.4836	-5.5189
HLA-A11:01	4UQ2	8901	SPSWPRKVRSPTTA	-10.0067	-10.1201
HLA-A11:01	4UQ2	8901	SPSWPRKVRSPTTA	-9.03915	-10.0745
HLA-A24:02	5HGA	8901	SPSWPRKVRSPTTA	-6.56204	-6.67544
HLA-A24:02	5HGA	8901	SPSWPRKVRSPTTA	-5.42271	-6.45801
HLA-B44:05	3DX8	8901	SPSWPRKVRSPTTA	-7.85648	-8.89178
HLA-B44:05	3DX8	8901	SPSWPRKVRSPTTA	-5.3978	-5.5112
HLA-A02:01	6TDR	8901	SPSWPRKVRSPTTA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of C19orf25-KLF2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
C19orf25-KLF2	chr19	1478771	chr19	16437665	12	20	KVRSPTTA	AAGGTGAGAAGCCCTACCACTGCA
C19orf25-KLF2	chr19	1478771	chr19	16437665	12	21	KVRSPTTAT	AAGGTGAGAAGCCCTACCACTGCAACT
C19orf25-KLF2	chr19	1478771	chr19	16437665	12	22	KVRSPTTATG	AAGGTGAGAAGCCCTACCACTGCAACTGGG
C19orf25-KLF2	chr19	1478771	chr19	16437665	6	15	SPSWPRKVR	TCACCATCCTGGCCCCGGAAGGTGAGA
C19orf25-KLF2	chr19	1478771	chr19	16437665	9	20	WPRKVRSPTTA	TGGCCCCGGAAGGTGAGAAGCCCTACCACTGCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
C19orf25-KLF2	chr19	1478771	chr19	16437665	0	15	RQRIQCSPSWPRKVR	CGGCAGAGGATCCAGTGTTCACCATCCTGGCCCCGGAAGGTGAGA
C19orf25-KLF2	chr19	1478771	chr19	16437665	10	25	DPVFTILAPEGEKPY	CCCCGGAAGGTGAGAAGCCCTACCACTGCAACTGGGACGGCTGCG
C19orf25-KLF2	chr19	1478771	chr19	16437665	11	26	PVFTILAPEGEKPYH	CGGAAGGTGAGAAGCCCTACCACTGCAACTGGGACGGCTGCGGCT
C19orf25-KLF2	chr19	1478771	chr19	16437665	8	23	AEDPVFTILAPEGEK	TCCTGGCCCCGGAAGGTGAGAAGCCCTACCACTGCAACTGGGACG
C19orf25-KLF2	chr19	1478771	chr19	16437665	9	24	EDPVFTILAPEGEKP	TGGCCCCGGAAGGTGAGAAGCCCTACCACTGCAACTGGGACGGCT

Top

Information of the samples that have these potential fusion neoantigens of C19orf25-KLF2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	C19orf25-KLF2	chr19	1478771	ENST00000586564	chr19	16437665	ENST00000592003	AJ713185

Top

Potential target of CAR-T therapy development for C19orf25-KLF2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to C19orf25-KLF2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to C19orf25-KLF2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)