Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:C8orf76-ATAD2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: C8orf76-ATAD2
	FusionPDB ID: 12089
	FusionGDB2.0 ID: 12089
		Hgene	Tgene
	Gene symbol	C8orf76	ATAD2
	Gene ID	84933	29028
	Gene name	chromosome 8 open reading frame 76	ATPase family AAA domain containing 2
	Synonyms	-	ANCCA\|CT137\|PRO2000
	Cytomap	8q24.13	8q24.13
	Type of gene	protein-coding	protein-coding
	Description	uncharacterized protein C8orf76	ATPase family AAA domain-containing protein 2AAA nuclear coregulator cancer-associated protein
	Modification date	20200313	20200322
	UniProtAcc	Q96K31 Main function of 5'-partner protein:	Q9ULI0 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000276704, ENST00000521310,	ENST00000521903, ENST00000534257, ENST00000287394,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 5 X 6=120	7 X 6 X 8=336
	# samples	7	9
	** MAII score	log2(7/120*10)=-0.777607578663552 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/336*10)=-1.90046432644909 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: C8orf76 [Title/Abstract] AND ATAD2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: C8orf76 [Title/Abstract] AND ATAD2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	C8orf76(124238740)-ATAD2(124335306), # samples:2 C8orf76(124250038)-ATAD2(124351686), # samples:2
Anticipated loss of major functional domain due to fusion event.	C8orf76-ATAD2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C8orf76-ATAD2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C8orf76-ATAD2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. C8orf76-ATAD2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. C8orf76-ATAD2 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. C8orf76-ATAD2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. C8orf76-ATAD2 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ATAD2	GO:0045893	positive regulation of transcription, DNA-templated	17998543

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:124238740/chr8:124335306)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across C8orf76 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ATAD2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000276704	C8orf76	chr8	124250038	-	ENST00000287394	ATAD2	chr8	124351686	-	3148	409	52	1863	603
ENST00000276704	C8orf76	chr8	124250038	-	ENST00000521903	ATAD2	chr8	124351686	-	2496	409	52	1863	603

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000276704	ENST00000287394	C8orf76	chr8	124250038	-	ATAD2	chr8	124351686	-	0.000116739	0.9998833
ENST00000276704	ENST00000521903	C8orf76	chr8	124250038	-	ATAD2	chr8	124351686	-	0.000201499	0.9997985

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for C8orf76-ATAD2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
C8orf76	chr8	124250038	ATAD2	chr8	124351686	409	119	GRHMEALEIAANLVQELFIRDYGEIF

Top

Potential FusionNeoAntigen Information of C8orf76-ATAD2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

C8orf76-ATAD2_124250038_124351686.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B15:17	AANLVQELF	0.9974	0.8922	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B57:01	AANLVQELF	0.9972	0.9858	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:03	IAANLVQEL	0.9966	0.9089	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B15:16	AANLVQELF	0.9963	0.8259	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B58:02	AANLVQELF	0.9943	0.9686	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B58:01	AANLVQELF	0.9936	0.9741	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B52:01	IAANLVQEL	0.9929	0.9782	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B57:03	AANLVQELF	0.9865	0.9887	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:05	IAANLVQEL	0.9862	0.6621	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:02	IAANLVQEL	0.9833	0.9274	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:04	IAANLVQEL	0.9833	0.9274	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B53:01	AANLVQELF	0.9721	0.6499	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B46:01	AANLVQELF	0.9277	0.5067	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-A32:13	AANLVQELF	0.7893	0.9612	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B13:01	AANLVQELF	0.1121	0.9461	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B57:03	IAANLVQELF	0.9994	0.9742	8	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:19	AANLVQEL	1	0.9933	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:08	AANLVQEL	0.9999	0.9385	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:13	AANLVQEL	0.9987	0.9862	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:04	AANLVQEL	0.9987	0.9862	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C02:06	AANLVQEL	0.9959	0.9581	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:03	AANLVQEL	0.9335	0.9952	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:08	IAANLVQEL	0.9999	0.9062	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C15:04	IAANLVQEL	0.9999	0.8437	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:19	IAANLVQEL	0.9999	0.9877	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:07	IAANLVQEL	0.9998	0.9756	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C15:06	IAANLVQEL	0.9998	0.8967	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C04:06	IAANLVQEL	0.9997	0.9564	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C05:09	IAANLVQEL	0.9995	0.9864	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C12:16	IAANLVQEL	0.9993	0.9677	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:04	IAANLVQEL	0.9993	0.9713	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:13	IAANLVQEL	0.9993	0.9713	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C12:04	IAANLVQEL	0.9993	0.9939	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C12:12	IAANLVQEL	0.9992	0.9583	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C06:03	IAANLVQEL	0.9992	0.9951	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:15	IAANLVQEL	0.9984	0.9941	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C04:14	IAANLVQEL	0.9977	0.9527	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C01:17	IAANLVQEL	0.9957	0.9524	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C01:30	IAANLVQEL	0.9939	0.9669	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C15:04	AANLVQELF	0.992	0.9519	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B51:07	IAANLVQEL	0.9915	0.9512	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:12	IAANLVQEL	0.9833	0.9274	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:13	IAANLVQEL	0.9806	0.9536	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C02:06	IAANLVQEL	0.9795	0.9448	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:05	IAANLVQEL	0.9793	0.9726	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:29	IAANLVQEL	0.9779	0.9547	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:03	IAANLVQEL	0.9777	0.992	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:14	IAANLVQEL	0.9775	0.9811	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:19	IAANLVQEL	0.9698	0.8025	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:27	IAANLVQEL	0.9614	0.9626	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:95	IAANLVQEL	0.9539	0.7474	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B39:10	IAANLVQEL	0.8329	0.9673	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:14	AANLVQELF	0.7957	0.9871	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:03	AANLVQEL	1	0.9925	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:04	AANLVQEL	1	0.9925	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:17	AANLVQEL	0.9999	0.9779	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:05	AANLVQEL	0.9998	0.9483	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:04	AANLVQEL	0.9992	0.976	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:02	AANLVQEL	0.9947	0.9946	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:13	AANLVQEL	0.9822	0.9306	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:01	AANLVQEL	0.974	0.987	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:01	AANLVQEL	0.9335	0.9952	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B07:13	AANLVQEL	0.9123	0.848	9	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:03	IAANLVQEL	0.9999	0.988	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:04	IAANLVQEL	0.9999	0.988	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C15:09	IAANLVQEL	0.9999	0.8437	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C15:05	IAANLVQEL	0.9998	0.925	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:67	IAANLVQEL	0.9998	0.9817	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C15:02	IAANLVQEL	0.9998	0.8521	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:02	IAANLVQEL	0.9997	0.9683	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:05	IAANLVQEL	0.9997	0.921	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C12:02	IAANLVQEL	0.9997	0.9703	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:17	IAANLVQEL	0.9996	0.9689	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C04:04	IAANLVQEL	0.9996	0.9482	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C05:01	IAANLVQEL	0.9995	0.9864	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:04	IAANLVQEL	0.9995	0.9848	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C12:03	IAANLVQEL	0.9994	0.9837	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C04:03	IAANLVQEL	0.9994	0.9613	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:02	AANLVQELF	0.9993	0.9769	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C03:06	IAANLVQEL	0.9992	0.9894	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C06:02	IAANLVQEL	0.9988	0.9938	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C06:17	IAANLVQEL	0.9988	0.9938	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:02	IAANLVQEL	0.9984	0.9941	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B57:04	AANLVQELF	0.9984	0.9004	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C01:03	IAANLVQEL	0.9983	0.9735	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C06:06	IAANLVQEL	0.9982	0.9849	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B57:10	AANLVQELF	0.9972	0.9858	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:02	IAANLVQEL	0.9969	0.9894	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B58:06	AANLVQELF	0.9965	0.9301	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C01:02	IAANLVQEL	0.9958	0.9496	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:01	IAANLVQEL	0.9956	0.9759	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:13	IAANLVQEL	0.9954	0.9142	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B78:02	IAANLVQEL	0.9937	0.7743	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:28	AANLVQELF	0.9933	0.9371	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C15:09	AANLVQELF	0.992	0.9519	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B15:73	IAANLVQEL	0.9899	0.9584	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:04	IAANLVQEL	0.9897	0.9718	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B57:02	AANLVQELF	0.9888	0.937	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:17	IAANLVQEL	0.988	0.97	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B15:30	IAANLVQEL	0.9877	0.9113	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:17	IAANLVQEL	0.9865	0.834	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:30	IAANLVQEL	0.9865	0.834	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:22	IAANLVQEL	0.9838	0.8151	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:09	IAANLVQEL	0.9833	0.9274	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B35:43	IAANLVQEL	0.9787	0.8299	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C08:01	IAANLVQEL	0.9777	0.992	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C02:02	IAANLVQEL	0.9764	0.9628	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C02:10	IAANLVQEL	0.9764	0.9628	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C06:08	IAANLVQEL	0.9609	0.9869	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-A02:14	IAANLVQEL	0.9571	0.6496	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C07:01	IAANLVQEL	0.9561	0.7538	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B15:24	AANLVQELF	0.9364	0.9281	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B07:13	IAANLVQEL	0.9286	0.8465	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C12:02	AANLVQELF	0.9213	0.9737	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C17:01	IAANLVQEL	0.8966	0.936	8	17
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:01	AANLVQELF	0.8367	0.9863	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C16:02	AANLVQELF	0.6976	0.9945	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C02:10	AANLVQELF	0.4841	0.9667	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-C02:02	AANLVQELF	0.4841	0.9667	9	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-B57:02	IAANLVQELF	0.9995	0.8877	8	18
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-A68:02	EALEIAANLV	0.9977	0.628	4	14
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	HLA-A69:01	EALEIAANLV	0.9955	0.5918	4	14

Top

Potential FusionNeoAntigen Information of C8orf76-ATAD2 in HLA II

C8orf76-ATAD2_124250038_124351686.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C8orf76-ATAD2	chr8	124250038	chr8	124351686	409	DRB1-1002	GRHMEALEIAANLVQ	0	15

Top

Fusion breakpoint peptide structures of C8orf76-ATAD2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4894	LEIAANLVQELFIR	C8orf76	ATAD2	chr8	124250038	chr8	124351686	409

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of C8orf76-ATAD2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4894	LEIAANLVQELFIR	-7.15543	-7.26883
HLA-B14:02	3BVN	4894	LEIAANLVQELFIR	-4.77435	-5.80965
HLA-B52:01	3W39	4894	LEIAANLVQELFIR	-6.80875	-6.92215
HLA-B52:01	3W39	4894	LEIAANLVQELFIR	-4.20386	-5.23916
HLA-A11:01	4UQ2	4894	LEIAANLVQELFIR	-7.5194	-8.5547
HLA-A11:01	4UQ2	4894	LEIAANLVQELFIR	-6.9601	-7.0735
HLA-A24:02	5HGA	4894	LEIAANLVQELFIR	-7.52403	-7.63743
HLA-A24:02	5HGA	4894	LEIAANLVQELFIR	-5.82433	-6.85963
HLA-B27:05	6PYJ	4894	LEIAANLVQELFIR	-3.28285	-4.31815
HLA-B44:05	3DX8	4894	LEIAANLVQELFIR	-5.91172	-6.94702
HLA-B44:05	3DX8	4894	LEIAANLVQELFIR	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of C8orf76-ATAD2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
C8orf76-ATAD2	chr8	124250038	chr8	124351686	4	14	EALEIAANLV	GAGGCGCTGGAGATTGCTGCAAACTTGGTG
C8orf76-ATAD2	chr8	124250038	chr8	124351686	8	17	IAANLVQEL	ATTGCTGCAAACTTGGTGCAAGAATTG
C8orf76-ATAD2	chr8	124250038	chr8	124351686	8	18	IAANLVQELF	ATTGCTGCAAACTTGGTGCAAGAATTGTTT
C8orf76-ATAD2	chr8	124250038	chr8	124351686	9	17	AANLVQEL	GCTGCAAACTTGGTGCAAGAATTG
C8orf76-ATAD2	chr8	124250038	chr8	124351686	9	18	AANLVQELF	GCTGCAAACTTGGTGCAAGAATTGTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
C8orf76-ATAD2	chr8	124250038	chr8	124351686	0	15	GRHMEALEIAANLVQ	GGTAGGCATATGGAGGCGCTGGAGATTGCTGCAAACTTGGTGCAA

Top

Information of the samples that have these potential fusion neoantigens of C8orf76-ATAD2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
KIRC	C8orf76-ATAD2	chr8	124250038	ENST00000276704	chr8	124351686	ENST00000287394	TCGA-BP-4962-01A

Top

Potential target of CAR-T therapy development for C8orf76-ATAD2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to C8orf76-ATAD2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to C8orf76-ATAD2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)