Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CA3-MYBL1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CA3-MYBL1
	FusionPDB ID: 12189
	FusionGDB2.0 ID: 12189
		Hgene	Tgene
	Gene symbol	CA3	MYBL1
	Gene ID	761	4603
	Gene name	carbonic anhydrase 3	MYB proto-oncogene like 1
	Synonyms	CAIII\|Car3	A-MYB\|AMYB
	Cytomap	8q21.2	8q13.1
	Type of gene	protein-coding	protein-coding
	Description	carbonic anhydrase 3CA-IIIHEL-S-167mPcarbonate dehydratase IIIcarbonic anhydrase III, muscle specificcarbonic anhydrase IIIIepididymis secretory sperm binding protein Li 167mP	myb-related protein Amyb-like protein 1v-myb avian myeloblastosis viral oncogene homolog-like 1
	Modification date	20200313	20200313
	UniProtAcc	P07451 Main function of 5'-partner protein: FUNCTION: Reversible hydration of carbon dioxide.	P10243 Main function of 5'-partner protein: FUNCTION: Transcription factor that specifically recognizes the sequence 5'-YAAC[GT]G-3' (PubMed:8058310, PubMed:7987850). Acts as a master regulator of male meiosis by promoting expression of piRNAs: activates expression of both piRNA precursor RNAs and expression of protein-coding genes involved in piRNA metabolism (By similarity). The piRNA metabolic process mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and governs the methylation and subsequent repression of transposons, which is essential for the germline integrity (By similarity). Transcriptional activator of SOX30 (By similarity). {ECO:0000250\|UniProtKB:P51960, ECO:0000269\|PubMed:7987850, ECO:0000269\|PubMed:8058310}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000285381,	ENST00000522419, ENST00000517885, ENST00000522677, ENST00000524176,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 2 X 2=8	1 X 1 X 1=1
	# samples	2	1
	** MAII score	log2(2/8*10)=1.32192809488736	log2(1/1*10)=3.32192809488736
Fusion gene context	PubMed: CA3 [Title/Abstract] AND MYBL1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CA3 [Title/Abstract] AND MYBL1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CA3(86356355)-MYBL1(67479227), # samples:3
Anticipated loss of major functional domain due to fusion event.	CA3-MYBL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CA3-MYBL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CA3-MYBL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CA3-MYBL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MYBL1	GO:0045944	positive regulation of transcription by RNA polymerase II	7987850

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:86356355/chr8:67479227)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CA3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MYBL1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000285381	CA3	chr8	86356355	+	ENST00000522677	MYBL1	chr8	67479227	-	3580	527	83	1057	324
ENST00000285381	CA3	chr8	86356355	+	ENST00000517885	MYBL1	chr8	67479227	-	1083	527	83	1057	324
ENST00000285381	CA3	chr8	86356355	+	ENST00000524176	MYBL1	chr8	67479227	-	878	527	83	877	265

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000285381	ENST00000522677	CA3	chr8	86356355	+	MYBL1	chr8	67479227	-	0.000143948	0.999856
ENST00000285381	ENST00000517885	CA3	chr8	86356355	+	MYBL1	chr8	67479227	-	0.001487516	0.99851245
ENST00000285381	ENST00000524176	CA3	chr8	86356355	+	MYBL1	chr8	67479227	-	0.006681499	0.99331856

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CA3-MYBL1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CA3	chr8	86356355	MYBL1	chr8	67479227	527	148	QRDGIAVIGIFLKSQPLAFLEEDIRE

Top

Potential FusionNeoAntigen Information of CA3-MYBL1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CA3-MYBL1_86356355_67479227.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:09	FLKSQPLA	0.9846	0.6998	10	18
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:03	LKSQPLAF	0.9646	0.8289	11	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:01	FLKSQPLAF	0.9997	0.9452	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:25	FLKSQPLAF	0.9966	0.9641	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:02	FLKSQPLAF	0.9961	0.9708	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B46:01	FLKSQPLAF	0.996	0.5734	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:01	GIFLKSQPL	0.9804	0.694	8	17
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:01	FLKSQPLAF	0.9742	0.6487	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:03	FLKSQPLAF	0.9715	0.8958	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:09	FLKSQPLAF	0.9638	0.6916	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B35:05	FLKSQPLAF	0.9484	0.7101	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:18	FLKSQPLAF	0.9371	0.8379	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A32:13	FLKSQPLAF	0.8162	0.9736	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B13:01	FLKSQPLAF	0.1095	0.9713	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A02:22	FLKSQPLAFL	0.9952	0.6702	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A02:11	FLKSQPLAFL	0.9727	0.6724	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A02:13	FLKSQPLAFL	0.9707	0.7545	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:01	FLKSQPLAFL	0.9527	0.672	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A02:04	FLKSQPLAFL	0.9523	0.6693	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:01	IFLKSQPLAF	0.9338	0.9468	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A02:17	FLKSQPLAFL	0.9307	0.5736	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:25	IFLKSQPLAF	0.9219	0.9589	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:07	FLKSQPLAF	0.9995	0.7796	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C12:16	FLKSQPLAF	0.9977	0.9765	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C12:12	FLKSQPLAF	0.9965	0.8985	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:04	FLKSQPLAF	0.9952	0.969	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:21	FLKSQPLAF	0.9951	0.9507	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B42:02	FLKSQPLAF	0.9814	0.6282	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C12:04	FLKSQPLAF	0.9688	0.9933	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C06:03	FLKSQPLAF	0.9652	0.9923	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:31	FLKSQPLAF	0.9495	0.905	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:05	FLKSQPLAF	0.9405	0.8976	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:05	FLKSQPLAF	0.7597	0.9575	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C15:04	FLKSQPLAF	0.7323	0.8378	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:29	FLKSQPLAF	0.7089	0.9556	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C03:07	FLKSQPLAF	0.705	0.9645	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C03:14	FLKSQPLAF	0.7019	0.9716	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:80	FLKSQPLAF	0.6855	0.9545	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:67	FLKSQPLAF	0.6855	0.9545	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:13	FLKSQPLAF	0.684	0.9507	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:10	FLKSQPLAF	0.6764	0.9545	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:27	FLKSQPLAF	0.6663	0.9647	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:46	FLKSQPLAF	0.6629	0.91	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:19	FLKSQPLAF	0.622	0.8252	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:95	FLKSQPLAF	0.6121	0.8274	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C04:14	FLKSQPLAF	0.6049	0.9215	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A02:02	FLKSQPLAFL	0.9956	0.5085	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:07	IFLKSQPLAF	0.9575	0.7796	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:07	GIFLKSQPLAF	0.9992	0.7918	8	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C14:03	IFLKSQPL	0.9181	0.9388	9	17
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C14:02	IFLKSQPL	0.9181	0.9388	9	17
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:27	FLKSQPLAF	0.9997	0.9528	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:34	FLKSQPLAF	0.9997	0.9452	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:125	FLKSQPLAF	0.9997	0.9452	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:33	FLKSQPLAF	0.9997	0.9452	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:50	FLKSQPLAF	0.9996	0.9479	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:135	FLKSQPLAF	0.9996	0.9659	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:08	FLKSQPLAF	0.9996	0.9241	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:11	FLKSQPLAF	0.9996	0.927	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:35	FLKSQPLAF	0.9995	0.9529	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B35:43	FLKSQPLAF	0.9994	0.9253	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:24	FLKSQPLAF	0.9993	0.9693	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:53	FLKSQPLAF	0.9992	0.9378	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:54	FLKSQPLAF	0.9989	0.9256	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:12	FLKSQPLAF	0.9987	0.9429	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:68	FLKSQPLAF	0.9977	0.7368	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:39	FLKSQPLAF	0.9963	0.9222	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B35:11	FLKSQPLAF	0.9951	0.9522	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C12:02	FLKSQPLAF	0.9949	0.9788	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C12:03	FLKSQPLAF	0.9949	0.9788	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C03:02	FLKSQPLAF	0.9886	0.978	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:13	FLKSQPLAF	0.9865	0.6529	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C03:04	FLKSQPLAF	0.9855	0.9907	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C03:03	FLKSQPLAF	0.9855	0.9907	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:18	GIFLKSQPL	0.9804	0.694	8	17
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C03:67	FLKSQPLAF	0.9782	0.9858	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:18	FLKSQPLAF	0.9742	0.6487	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C16:04	FLKSQPLAF	0.9705	0.9826	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:73	FLKSQPLAF	0.965	0.9778	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B35:23	FLKSQPLAF	0.9431	0.9093	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:30	FLKSQPLAF	0.9406	0.9587	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B35:20	FLKSQPLAF	0.9338	0.9409	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:20	FLKSQPLAF	0.9216	0.9337	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B35:28	FLKSQPLAF	0.9126	0.9391	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C16:01	FLKSQPLAF	0.8987	0.9746	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C03:05	FLKSQPLAF	0.8984	0.9383	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:22	FLKSQPLAF	0.8882	0.8426	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A32:01	FLKSQPLAF	0.869	0.9705	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:73	GIFLKSQPL	0.844	0.9454	8	17
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:04	FLKSQPLAF	0.8372	0.9664	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B48:02	FLKSQPLAF	0.8154	0.9255	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B35:24	FLKSQPLAF	0.7752	0.932	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C06:06	FLKSQPLAF	0.7502	0.9888	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C15:09	FLKSQPLAF	0.7323	0.8378	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:12	FLKSQPLAF	0.7285	0.8341	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:30	GIFLKSQPL	0.7284	0.8799	8	17
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:17	FLKSQPLAF	0.7222	0.9718	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:12	GIFLKSQPL	0.7004	0.8017	8	17
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:02	FLKSQPLAF	0.6855	0.9545	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C02:02	FLKSQPLAF	0.6318	0.9802	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C02:10	FLKSQPLAF	0.6318	0.9802	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C07:01	FLKSQPLAF	0.6249	0.8239	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C14:03	FLKSQPLAF	0.5978	0.9556	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C14:02	FLKSQPLAF	0.5978	0.9556	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B18:04	FLKSQPLAF	0.54	0.9255	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B18:07	FLKSQPLAF	0.3821	0.8973	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C04:04	FLKSQPLAF	0.3619	0.9524	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C18:01	FLKSQPLAF	0.2296	0.8555	10	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-A02:03	FLKSQPLAFL	0.9972	0.7539	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:35	IFLKSQPLAF	0.9659	0.9529	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:18	FLKSQPLAFL	0.9527	0.672	10	20
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:27	IFLKSQPLAF	0.9366	0.9572	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:33	IFLKSQPLAF	0.9338	0.9468	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:125	IFLKSQPLAF	0.9338	0.9468	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:34	IFLKSQPLAF	0.9338	0.9468	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:135	IFLKSQPLAF	0.9328	0.9597	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:39	IFLKSQPLAF	0.9201	0.9209	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:24	IFLKSQPLAF	0.9169	0.9649	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:50	IFLKSQPLAF	0.9138	0.9594	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B15:12	IFLKSQPLAF	0.8953	0.925	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C14:02	IFLKSQPLAF	0.8653	0.94	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-C14:03	IFLKSQPLAF	0.8653	0.94	9	19
CA3-MYBL1	chr8	86356355	chr8	67479227	527	HLA-B08:12	FLKSQPLAFL	0.752	0.8458	10	20

Top

Potential FusionNeoAntigen Information of CA3-MYBL1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CA3-MYBL1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10012	VIGIFLKSQPLAFL	CA3	MYBL1	chr8	86356355	chr8	67479227	527

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CA3-MYBL1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10012	VIGIFLKSQPLAFL	-7.9962	-8.1096
HLA-B14:02	3BVN	10012	VIGIFLKSQPLAFL	-5.70842	-6.74372
HLA-B52:01	3W39	10012	VIGIFLKSQPLAFL	-6.83737	-6.95077
HLA-B52:01	3W39	10012	VIGIFLKSQPLAFL	-4.4836	-5.5189
HLA-A11:01	4UQ2	10012	VIGIFLKSQPLAFL	-10.0067	-10.1201
HLA-A11:01	4UQ2	10012	VIGIFLKSQPLAFL	-9.03915	-10.0745
HLA-A24:02	5HGA	10012	VIGIFLKSQPLAFL	-6.56204	-6.67544
HLA-A24:02	5HGA	10012	VIGIFLKSQPLAFL	-5.42271	-6.45801
HLA-B44:05	3DX8	10012	VIGIFLKSQPLAFL	-7.85648	-8.89178
HLA-B44:05	3DX8	10012	VIGIFLKSQPLAFL	-5.3978	-5.5112
HLA-B35:01	1A1N	10012	VIGIFLKSQPLAFL	-6.27422	-6.38762
HLA-B35:01	1A1N	10012	VIGIFLKSQPLAFL	-5.27424	-6.30954
HLA-A02:01	6TDR	10012	VIGIFLKSQPLAFL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of CA3-MYBL1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CA3-MYBL1	chr8	86356355	chr8	67479227	10	18	FLKSQPLA	TTTCTGAAGTCCCAGCCACTTGCT
CA3-MYBL1	chr8	86356355	chr8	67479227	10	19	FLKSQPLAF	TTTCTGAAGTCCCAGCCACTTGCTTTC
CA3-MYBL1	chr8	86356355	chr8	67479227	10	20	FLKSQPLAFL	TTTCTGAAGTCCCAGCCACTTGCTTTCTTG
CA3-MYBL1	chr8	86356355	chr8	67479227	11	19	LKSQPLAF	CTGAAGTCCCAGCCACTTGCTTTC
CA3-MYBL1	chr8	86356355	chr8	67479227	8	17	GIFLKSQPL	GGCATTTTTCTGAAGTCCCAGCCACTT
CA3-MYBL1	chr8	86356355	chr8	67479227	8	19	GIFLKSQPLAF	GGCATTTTTCTGAAGTCCCAGCCACTTGCTTTC
CA3-MYBL1	chr8	86356355	chr8	67479227	9	17	IFLKSQPL	ATTTTTCTGAAGTCCCAGCCACTT
CA3-MYBL1	chr8	86356355	chr8	67479227	9	19	IFLKSQPLAF	ATTTTTCTGAAGTCCCAGCCACTTGCTTTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CA3-MYBL1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	CA3-MYBL1	chr8	86356355	ENST00000285381	chr8	67479227	ENST00000517885	TCGA-AR-A256-01A

Top

Potential target of CAR-T therapy development for CA3-MYBL1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CA3-MYBL1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CA3-MYBL1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)