![]() |
|||||||
|
Fusion Protein:CAMK2B-ICT1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: CAMK2B-ICT1 | FusionPDB ID: 12660 | FusionGDB2.0 ID: 12660 | Hgene | Tgene | Gene symbol | CAMK2B | ICT1 | Gene ID | 816 | 3396 |
Gene name | calcium/calmodulin dependent protein kinase II beta | mitochondrial ribosomal protein L58 | |
Synonyms | CAM2|CAMK2|CAMKB|CaMKIIbeta|MRD54 | DS-1|DS1|ICT1|MRP-L58 | |
Cytomap | 7p13 | 17q25.1 | |
Type of gene | protein-coding | protein-coding | |
Description | calcium/calmodulin-dependent protein kinase type II subunit betaCaM kinase II beta subunitCaM-kinase II beta chaincaMK-II subunit betaproline rich calmodulin-dependent protein kinase | peptidyl-tRNA hydrolase ICT1, mitochondrial39S ribosomal protein L58, mitochondrialdigestion substraction 1immature colon carcinoma transcript 1 proteinmitochondrial large ribosomal subunit protein ICT1mitochondrial large ribosomal subunit protein mL | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q13554 Main function of 5'-partner protein: FUNCTION: Calcium/calmodulin-dependent protein kinase that functions autonomously after Ca(2+)/calmodulin-binding and autophosphorylation, and is involved in dendritic spine and synapse formation, neuronal plasticity and regulation of sarcoplasmic reticulum Ca(2+) transport in skeletal muscle. In neurons, plays an essential structural role in the reorganization of the actin cytoskeleton during plasticity by binding and bundling actin filaments in a kinase-independent manner. This structural function is required for correct targeting of CaMK2A, which acts downstream of NMDAR to promote dendritic spine and synapse formation and maintain synaptic plasticity which enables long-term potentiation (LTP) and hippocampus-dependent learning. In developing hippocampal neurons, promotes arborization of the dendritic tree and in mature neurons, promotes dendritic remodeling. Also regulates the migration of developing neurons (PubMed:29100089). Participates in the modulation of skeletal muscle function in response to exercise. In slow-twitch muscles, is involved in regulation of sarcoplasmic reticulum (SR) Ca(2+) transport and in fast-twitch muscle participates in the control of Ca(2+) release from the SR through phosphorylation of triadin, a ryanodine receptor-coupling factor, and phospholamban (PLN/PLB), an endogenous inhibitor of SERCA2A/ATP2A2. {ECO:0000269|PubMed:16690701, ECO:0000269|PubMed:29100089}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000502837, ENST00000258682, ENST00000346990, ENST00000347193, ENST00000350811, ENST00000353625, ENST00000358707, ENST00000395747, ENST00000395749, ENST00000440254, ENST00000457475, ENST00000489429, | ENST00000301585, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 4 X 4=64 | 5 X 4 X 3=60 |
# samples | 4 | 7 | |
** MAII score | log2(4/64*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/60*10)=0.222392421336448 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: CAMK2B [Title/Abstract] AND ICT1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: CAMK2B [Title/Abstract] AND ICT1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CAMK2B(44302603)-ICT1(73015794), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | CAMK2B-ICT1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CAMK2B-ICT1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | CAMK2B | GO:0046777 | protein autophosphorylation | 18817731 |
Tgene | ICT1 | GO:0070126 | mitochondrial translational termination | 20186120 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:44302603/chr17:73015794) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000350811 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 949 | 295 | 75 | 692 | 205 |
ENST00000457475 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 1084 | 430 | 210 | 827 | 205 |
ENST00000395749 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 951 | 297 | 77 | 694 | 205 |
ENST00000440254 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 1109 | 455 | 235 | 852 | 205 |
ENST00000358707 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 1078 | 424 | 204 | 821 | 205 |
ENST00000353625 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 884 | 230 | 10 | 627 | 205 |
ENST00000258682 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 877 | 223 | 3 | 620 | 205 |
ENST00000347193 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 877 | 223 | 3 | 620 | 205 |
ENST00000346990 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 877 | 223 | 3 | 620 | 205 |
ENST00000395747 | CAMK2B | chr7 | 44302603 | - | ENST00000301585 | ICT1 | chr17 | 73015794 | + | 874 | 220 | 0 | 617 | 205 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000350811 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.00312194 | 0.996878 |
ENST00000457475 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.005563513 | 0.9944365 |
ENST00000395749 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.003229687 | 0.9967704 |
ENST00000440254 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.006094485 | 0.9939055 |
ENST00000358707 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.005093326 | 0.9949066 |
ENST00000353625 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.002447491 | 0.9975526 |
ENST00000258682 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.003087344 | 0.9969126 |
ENST00000347193 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.003087344 | 0.9969126 |
ENST00000346990 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.003087344 | 0.9969126 |
ENST00000395747 | ENST00000301585 | CAMK2B | chr7 | 44302603 | - | ICT1 | chr17 | 73015794 | + | 0.00348475 | 0.9965153 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CAMK2B-ICT1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 220 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 223 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 230 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 295 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 297 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 424 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 430 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
CAMK2B | chr7 | 44302603 | ICT1 | chr17 | 73015794 | 455 | 73 | EARICRLLKHSNIDRLTISYCRSSGP |
Top |
Potential FusionNeoAntigen Information of CAMK2B-ICT1 in HLA I |
![]() |
CAMK2B-ICT1_44302603_73015794.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B38:01 | KHSNIDRL | 0.993 | 0.8599 | 8 | 16 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:16 | HSNIDRLTI | 0.9887 | 0.5249 | 9 | 18 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:02 | NIDRLTISY | 0.9423 | 0.816 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:01 | NIDRLTISY | 0.8942 | 0.7999 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B38:01 | KHSNIDRLTI | 0.984 | 0.898 | 8 | 18 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-C15:06 | HSNIDRLTI | 0.9991 | 0.9259 | 9 | 18 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-C04:10 | NIDRLTISY | 0.986 | 0.5105 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-C04:07 | NIDRLTISY | 0.9859 | 0.5263 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:21 | NIDRLTISY | 0.9459 | 0.7908 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:05 | NIDRLTISY | 0.9259 | 0.7654 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:31 | NIDRLTISY | 0.8948 | 0.7764 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B38:05 | KHSNIDRL | 0.993 | 0.8599 | 8 | 16 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-C15:02 | HSNIDRLTI | 0.9992 | 0.9049 | 9 | 18 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-C15:05 | HSNIDRLTI | 0.9992 | 0.9422 | 9 | 18 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-C04:01 | NIDRLTISY | 0.9859 | 0.5263 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-C16:02 | HSNIDRLTI | 0.9703 | 0.9906 | 9 | 18 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:20 | NIDRLTISY | 0.9311 | 0.8345 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:11 | NIDRLTISY | 0.9296 | 0.7787 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:28 | NIDRLTISY | 0.9024 | 0.8247 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:20 | NIDRLTISY | 0.8949 | 0.8319 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:77 | NIDRLTISY | 0.8942 | 0.7999 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:23 | NIDRLTISY | 0.8921 | 0.788 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:11 | NIDRLTISY | 0.7659 | 0.7151 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B15:08 | NIDRLTISY | 0.7621 | 0.7003 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:24 | NIDRLTISY | 0.7312 | 0.8034 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:43 | NIDRLTISY | 0.7269 | 0.6909 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:17 | NIDRLTISY | 0.7243 | 0.5649 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B35:30 | NIDRLTISY | 0.7243 | 0.5649 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B18:04 | NIDRLTISY | 0.5897 | 0.8144 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B18:07 | NIDRLTISY | 0.3679 | 0.7625 | 11 | 20 |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 | HLA-B38:05 | KHSNIDRLTI | 0.984 | 0.898 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of CAMK2B-ICT1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of CAMK2B-ICT1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5231 | LLKHSNIDRLTISY | CAMK2B | ICT1 | chr7 | 44302603 | chr17 | 73015794 | 223 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CAMK2B-ICT1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5231 | LLKHSNIDRLTISY | -7.14368 | -7.25548 |
HLA-B14:02 | 3BVN | 5231 | LLKHSNIDRLTISY | -6.90724 | -7.95034 |
HLA-B52:01 | 3W39 | 5231 | LLKHSNIDRLTISY | -7.67666 | -8.71976 |
HLA-B52:01 | 3W39 | 5231 | LLKHSNIDRLTISY | -5.5221 | -5.6339 |
HLA-A11:01 | 4UQ2 | 5231 | LLKHSNIDRLTISY | -8.37369 | -9.41679 |
HLA-A11:01 | 4UQ2 | 5231 | LLKHSNIDRLTISY | -6.26273 | -6.37453 |
HLA-A24:02 | 5HGA | 5231 | LLKHSNIDRLTISY | -7.6158 | -8.6589 |
HLA-A24:02 | 5HGA | 5231 | LLKHSNIDRLTISY | -5.36701 | -5.47881 |
HLA-B44:05 | 3DX8 | 5231 | LLKHSNIDRLTISY | -8.09865 | -8.21045 |
HLA-B44:05 | 3DX8 | 5231 | LLKHSNIDRLTISY | -5.97829 | -7.02139 |
Top |
Vaccine Design for the FusionNeoAntigens of CAMK2B-ICT1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 11 | 20 | NIDRLTISY | ACATCGATCGCTTGACAATATCTTATT |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 8 | 16 | KHSNIDRL | AGCATTCCAACATCGATCGCTTGA |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 8 | 18 | KHSNIDRLTI | AGCATTCCAACATCGATCGCTTGACAATAT |
CAMK2B-ICT1 | chr7 | 44302603 | chr17 | 73015794 | 9 | 18 | HSNIDRLTI | ATTCCAACATCGATCGCTTGACAATAT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of CAMK2B-ICT1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | CAMK2B-ICT1 | chr7 | 44302603 | ENST00000258682 | chr17 | 73015794 | ENST00000301585 | TCGA-LN-A4MR |
Top |
Potential target of CAR-T therapy development for CAMK2B-ICT1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CAMK2B-ICT1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CAMK2B-ICT1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |