Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ACLY-TAF15

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ACLY-TAF15
	FusionPDB ID: 1332
	FusionGDB2.0 ID: 1332
		Hgene	Tgene
	Gene symbol	ACLY	TAF15
	Gene ID	47	8148
	Gene name	ATP citrate lyase	TATA-box binding protein associated factor 15
	Synonyms	ACL\|ATPCL\|CLATP	Npl3\|RBP56\|TAF2N\|TAFII68
	Cytomap	17q21.2	17q12
	Type of gene	protein-coding	protein-coding
	Description	ATP-citrate synthaseATP-citrate (pro-S-)-lyasecitrate cleavage enzyme	TATA-binding protein-associated factor 2NRBP56/CSMF fusionTAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDaTATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)TATA box-bin
	Modification date	20200313	20200313
	UniProtAcc	P53396 Main function of 5'-partner protein: FUNCTION: Catalyzes the cleavage of citrate into oxaloacetate and acetyl-CoA, the latter serving as common substrate for de novo cholesterol and fatty acid synthesis. {ECO:0000269\|PubMed:10653665, ECO:0000269\|PubMed:1371749, ECO:0000269\|PubMed:19286649, ECO:0000269\|PubMed:23932781, ECO:0000269\|PubMed:9116495}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000393896, ENST00000590151, ENST00000352035, ENST00000353196, ENST00000537919, ENST00000588779,	ENST00000311979, ENST00000588240, ENST00000592237,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 14 X 6=924	16 X 11 X 11=1936
	# samples	13	16
	** MAII score	log2(13/924*10)=-2.8293812283876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(16/1936*10)=-3.59693514238723 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ACLY [Title/Abstract] AND TAF15 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ACLY [Title/Abstract] AND TAF15 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ACLY(40054002)-TAF15(34163136), # samples:2
Anticipated loss of major functional domain due to fusion event.	ACLY-TAF15 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ACLY-TAF15 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ACLY-TAF15 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ACLY-TAF15 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ACLY-TAF15 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. ACLY-TAF15 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. ACLY-TAF15 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ACLY	GO:0006085	acetyl-CoA biosynthetic process	1371749
Hgene	ACLY	GO:0006101	citrate metabolic process	1371749
Hgene	ACLY	GO:0006107	oxaloacetate metabolic process	1371749
Hgene	ACLY	GO:0008610	lipid biosynthetic process	23932781
Tgene	TAF15	GO:0048255	mRNA stabilization	27378374

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:40054002/chr17:34163136)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ACLY (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TAF15 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000352035	ACLY	chr17	40054002	-	ENST00000588240	TAF15	chr17	34163136	+	2963	1560	131	2665	844
ENST00000352035	ACLY	chr17	40054002	-	ENST00000592237	TAF15	chr17	34163136	+	2642	1560	131	2509	792
ENST00000352035	ACLY	chr17	40054002	-	ENST00000311979	TAF15	chr17	34163136	+	2955	1560	131	2665	844
ENST00000353196	ACLY	chr17	40054002	-	ENST00000588240	TAF15	chr17	34163136	+	2995	1592	163	2697	844
ENST00000353196	ACLY	chr17	40054002	-	ENST00000592237	TAF15	chr17	34163136	+	2674	1592	163	2541	792
ENST00000353196	ACLY	chr17	40054002	-	ENST00000311979	TAF15	chr17	34163136	+	2987	1592	163	2697	844
ENST00000537919	ACLY	chr17	40054002	-	ENST00000588240	TAF15	chr17	34163136	+	2176	773	127	1878	583
ENST00000537919	ACLY	chr17	40054002	-	ENST00000592237	TAF15	chr17	34163136	+	1855	773	127	1722	531
ENST00000537919	ACLY	chr17	40054002	-	ENST00000311979	TAF15	chr17	34163136	+	2168	773	127	1878	583

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000352035	ENST00000588240	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.001222424	0.99877757
ENST00000352035	ENST00000592237	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.001055195	0.9989448
ENST00000352035	ENST00000311979	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.00123703	0.99876297
ENST00000353196	ENST00000588240	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.0012041	0.99879587
ENST00000353196	ENST00000592237	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.001023132	0.99897695
ENST00000353196	ENST00000311979	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.001218565	0.9987814
ENST00000537919	ENST00000588240	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.001868403	0.9981316
ENST00000537919	ENST00000592237	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.001136245	0.9988638
ENST00000537919	ENST00000311979	ACLY	chr17	40054002	-	TAF15	chr17	34163136	+	0.001928047	0.9980719

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ACLY-TAF15

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ACLY	chr17	40054002	TAF15	chr17	34163136	1560	476	VAPAKKAKPAMPQDSESDNSDNNTIF
ACLY	chr17	40054002	TAF15	chr17	34163136	1560	580	SFATRRPEFMRGGGSGGGRRGRGGYR
ACLY	chr17	40054002	TAF15	chr17	34163136	1560	702	SGDRSGGGYGGDRSGGGYGGDRGGGY
ACLY	chr17	40054002	TAF15	chr17	34163136	1560	723	RGGGYGGDRGGGYGGDRGGGYGGDRG
ACLY	chr17	40054002	TAF15	chr17	34163136	1560	738	DRGGGYGGDRGGYGGDRGGGYGGDRG
ACLY	chr17	40054002	TAF15	chr17	34163136	1592	476	VAPAKKAKPAMPQDSESDNSDNNTIF
ACLY	chr17	40054002	TAF15	chr17	34163136	1592	580	SFATRRPEFMRGGGSGGGRRGRGGYR
ACLY	chr17	40054002	TAF15	chr17	34163136	1592	702	SGDRSGGGYGGDRSGGGYGGDRGGGY
ACLY	chr17	40054002	TAF15	chr17	34163136	1592	723	RGGGYGGDRGGGYGGDRGGGYGGDRG
ACLY	chr17	40054002	TAF15	chr17	34163136	1592	738	DRGGGYGGDRGGYGGDRGGGYGGDRG
ACLY	chr17	40054002	TAF15	chr17	34163136	773	215	VAPAKKAKPAMPQDSESDNSDNNTIF
ACLY	chr17	40054002	TAF15	chr17	34163136	773	319	SFATRRPEFMRGGGSGGGRRGRGGYR
ACLY	chr17	40054002	TAF15	chr17	34163136	773	441	SGDRSGGGYGGDRSGGGYGGDRGGGY
ACLY	chr17	40054002	TAF15	chr17	34163136	773	462	RGGGYGGDRGGGYGGDRGGGYGGDRG
ACLY	chr17	40054002	TAF15	chr17	34163136	773	477	DRGGGYGGDRGGYGGDRGGGYGGDRG

Top

Potential FusionNeoAntigen Information of ACLY-TAF15 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA I

FusionNeoAntigen peptide

Binding score

Immunogenic score

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Potential FusionNeoAntigen Information of ACLY-TAF15 in HLA II

ACLY-TAF15_40054002_34163136.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0101	RGGYGGDRGGGYGGD	9	24
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0104	RGGYGGDRGGGYGGD	9	24
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0105	RGGYGGDRGGGYGGD	9	24
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0108	RGGYGGDRGGGYGGD	9	24
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0109	RGGYGGDRGGGYGGD	9	24
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0111	RGGYGGDRGGGYGGD	9	24
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0112	RGGYGGDRGGGYGGD	9	24
ACLY-TAF15	chr17	40054002	chr17	34163136	1560	DRB3-0113	RGGYGGDRGGGYGGD	9	24

Top

Fusion breakpoint peptide structures of ACLY-TAF15

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ACLY-TAF15

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele

PDB ID

File name

BPseq

Docking score

Glide score

Top

Vaccine Design for the FusionNeoAntigens of ACLY-TAF15

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide sequence

FusionNeoAntigen RNA sequence

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ACLY-TAF15	chr17	40054002	chr17	34163136	9	24	RGGYGGDRGGGYGGD	CCATGCCACAAGATTCAGAATCTGATAATTCAGATAACAACACAA

Top

Information of the samples that have these potential fusion neoantigens of ACLY-TAF15

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type

Fusion gene

Hchr

Hbp

Henst

Tchr

Tbp

Tenst

Sample

Top

Potential target of CAR-T therapy development for ACLY-TAF15

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ACLY-TAF15

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ACLY-TAF15

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)