Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CD58-CAPZA1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CD58-CAPZA1
	FusionPDB ID: 14559
	FusionGDB2.0 ID: 14559
		Hgene	Tgene
	Gene symbol	CD58	CAPZA1
	Gene ID	965	829
	Gene name	CD58 molecule	capping actin protein of muscle Z-line subunit alpha 1
	Synonyms	LFA-3\|LFA3\|ag3	CAPPA1\|CAPZ\|CAZ1
	Cytomap	1p13.1	1p13.2
	Type of gene	protein-coding	protein-coding
	Description	lymphocyte function-associated antigen 3CD58 antigen, (lymphocyte function-associated antigen 3)surface glycoprotein LFA-3	F-actin-capping protein subunit alpha-1Cap ZcapZ alpha-1capping actin protein of muscle Z-line alpha subunit 1capping protein (actin filament) muscle Z-line, alpha 1
	Modification date	20200313	20200327
	UniProtAcc	P19256 Main function of 5'-partner protein: FUNCTION: Ligand of the T-lymphocyte CD2 glycoprotein. This interaction is important in mediating thymocyte interactions with thymic epithelial cells, antigen-independent and -dependent interactions of T-lymphocytes with target cells and antigen-presenting cells and the T-lymphocyte rosetting with erythrocytes. In addition, the LFA-3/CD2 interaction may prime response by both the CD2+ and LFA-3+ cells.	P52907 Main function of 5'-partner protein: FUNCTION: F-actin-capping proteins bind in a Ca(2+)-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments. May play a role in the formation of epithelial cell junctions. {ECO:0000269\|PubMed:22891260}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000369487, ENST00000369489, ENST00000457047,	ENST00000476936, ENST00000263168,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 5 X 5=150	10 X 11 X 5=550
	# samples	6	10
	** MAII score	log2(6/150*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/550*10)=-2.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CD58 [Title/Abstract] AND CAPZA1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CD58 [Title/Abstract] AND CAPZA1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CD58(117113524)-CAPZA1(113189831), # samples:1
Anticipated loss of major functional domain due to fusion event.	CD58-CAPZA1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CD58-CAPZA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CD58	GO:0034113	heterotypic cell-cell adhesion	15345303
Hgene	CD58	GO:0071346	cellular response to interferon-gamma	19109405
Hgene	CD58	GO:0071356	cellular response to tumor necrosis factor	19109405

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:117113524/chr1:113189831)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CD58 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CAPZA1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000369489	CD58	chr1	117113524	-	ENST00000263168	CAPZA1	chr1	113189831	+	2446	137	11	958	315
ENST00000457047	CD58	chr1	117113524	-	ENST00000263168	CAPZA1	chr1	113189831	+	2433	124	10	945	311
ENST00000369487	CD58	chr1	117113524	-	ENST00000263168	CAPZA1	chr1	113189831	+	2446	137	11	958	315

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000369489	ENST00000263168	CD58	chr1	117113524	-	CAPZA1	chr1	113189831	+	0.000428863	0.99957114
ENST00000457047	ENST00000263168	CD58	chr1	117113524	-	CAPZA1	chr1	113189831	+	0.000477954	0.9995221
ENST00000369487	ENST00000263168	CD58	chr1	117113524	-	CAPZA1	chr1	113189831	+	0.000428863	0.99957114

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CD58-CAPZA1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CD58	chr1	117113524	CAPZA1	chr1	113189831	124	38	WGSSAWSACCTALVRIAAKFITHAPP
CD58	chr1	117113524	CAPZA1	chr1	113189831	137	42	WGSSAWSACCTALVRIAAKFITHAPP

Top

Potential FusionNeoAntigen Information of CD58-CAPZA1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CD58-CAPZA1_117113524_113189831.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B08:09	TALVRIAA	0.9995	0.6996	10	18
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:01	ALVRIAAKF	0.9464	0.9549	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:25	ALVRIAAKF	0.8923	0.9604	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-A32:13	ALVRIAAKF	0.8038	0.9387	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B13:01	ALVRIAAKF	0.0097	0.9802	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:07	ALVRIAAKF	0.9398	0.9085	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:05	ALVRIAAKF	0.3251	0.906	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:27	ALVRIAAKF	0.9483	0.9672	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:34	ALVRIAAKF	0.9464	0.9549	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:125	ALVRIAAKF	0.9464	0.9549	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:33	ALVRIAAKF	0.9464	0.9549	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:50	ALVRIAAKF	0.9456	0.9486	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:135	ALVRIAAKF	0.9428	0.9604	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:35	ALVRIAAKF	0.9409	0.9704	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:24	ALVRIAAKF	0.9227	0.9671	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-A32:01	ALVRIAAKF	0.9201	0.958	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:12	ALVRIAAKF	0.9098	0.9342	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:39	ALVRIAAKF	0.8888	0.9274	11	20
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	HLA-B15:20	ALVRIAAKF	0.3414	0.9395	11	20

Top

Potential FusionNeoAntigen Information of CD58-CAPZA1 in HLA II

CD58-CAPZA1_117113524_113189831.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	DRB1-1189	TALVRIAAKFITHAP	10	25
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	DRB1-1418	TALVRIAAKFITHAP	10	25
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	DRB1-1445	TALVRIAAKFITHAP	10	25
CD58-CAPZA1	chr1	117113524	chr1	113189831	137	DRB1-1481	TALVRIAAKFITHAP	10	25

Top

Fusion breakpoint peptide structures of CD58-CAPZA1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8370	SACCTALVRIAAKF	CD58	CAPZA1	chr1	117113524	chr1	113189831	137

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CD58-CAPZA1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	8370	SACCTALVRIAAKF	-7.90165	-7.90165
HLA-B44:05	3DX8	8370	SACCTALVRIAAKF	-5.81679	-5.81679

Top

Vaccine Design for the FusionNeoAntigens of CD58-CAPZA1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CD58-CAPZA1	chr1	117113524	chr1	113189831	10	18	TALVRIAA	ACTGCTTTGGTACGCATAGCTGCT
CD58-CAPZA1	chr1	117113524	chr1	113189831	11	20	ALVRIAAKF	GCTTTGGTACGCATAGCTGCTAAATTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CD58-CAPZA1	chr1	117113524	chr1	113189831	10	25	TALVRIAAKFITHAP	ACTGCTTTGGTACGCATAGCTGCTAAATTCATCACTCATGCACCC

Top

Information of the samples that have these potential fusion neoantigens of CD58-CAPZA1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	CD58-CAPZA1	chr1	117113524	ENST00000369487	chr1	113189831	ENST00000263168	2397N

Top

Potential target of CAR-T therapy development for CD58-CAPZA1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CD58-CAPZA1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CD58-CAPZA1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)