Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CDK1-NRG1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CDK1-NRG1
	FusionPDB ID: 15227
	FusionGDB2.0 ID: 15227
		Hgene	Tgene
	Gene symbol	CDK1	NRG1
	Gene ID	983	3084
	Gene name	cyclin dependent kinase 1	neuregulin 1
	Synonyms	CDC2\|CDC28A\|P34CDC2	ARIA\|GGF\|GGF2\|HGL\|HRG\|HRG1\|HRGA\|MST131\|MSTP131\|NDF\|NRG1-IT2\|SMDF
	Cytomap	10q21.2	8p12
	Type of gene	protein-coding	protein-coding
	Description	cyclin-dependent kinase 1cell cycle controller CDC2cell division control protein 2 homologcell division cycle 2, G1 to S and G2 to Mcell division protein kinase 1p34 protein kinase	pro-neuregulin-1, membrane-bound isoformacetylcholine receptor-inducing activityglial growth factor 2heregulin, alpha (45kD, ERBB2 p185-activator)neu differentiation factorpro-NRG1sensory and motor neuron derived factor
	Modification date	20200327	20200320
	UniProtAcc	Q9BWU1 Main function of 5'-partner protein:	Q02297 Main function of 5'-partner protein: FUNCTION: Direct ligand for ERBB3 and ERBB4 tyrosine kinase receptors. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. The multiple isoforms perform diverse functions such as inducing growth and differentiation of epithelial, glial, neuronal, and skeletal muscle cells; inducing expression of acetylcholine receptor in synaptic vesicles during the formation of the neuromuscular junction; stimulating lobuloalveolar budding and milk production in the mammary gland and inducing differentiation of mammary tumor cells; stimulating Schwann cell proliferation; implication in the development of the myocardium such as trabeculation of the developing heart. Isoform 10 may play a role in motor and sensory neuron development. Binds to ERBB4 (PubMed:10867024, PubMed:7902537). Binds to ERBB3 (PubMed:20682778). Acts as a ligand for integrins and binds (via EGF domain) to integrins ITGAV:ITGB3 or ITGA6:ITGB4. Its binding to integrins and subsequent ternary complex formation with integrins and ERRB3 are essential for NRG1-ERBB signaling. Induces the phosphorylation and activation of MAPK3/ERK1, MAPK1/ERK2 and AKT1 (PubMed:20682778). Ligand-dependent ERBB4 endocytosis is essential for the NRG1-mediated activation of these kinases in neurons (By similarity). {ECO:0000250\|UniProtKB:P43322, ECO:0000269\|PubMed:10867024, ECO:0000269\|PubMed:1348215, ECO:0000269\|PubMed:20682778, ECO:0000269\|PubMed:7902537}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000519760, ENST00000316629, ENST00000373809, ENST00000395284, ENST00000448257,	ENST00000287842, ENST00000287845, ENST00000338921, ENST00000341377, ENST00000356819, ENST00000405005, ENST00000519301, ENST00000520407, ENST00000520502, ENST00000521670, ENST00000523079, ENST00000539990, ENST00000523681,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 3=75	25 X 17 X 14=5950
	# samples	5	27
	** MAII score	log2(5/75*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(27/5950*10)=-4.46185835603184 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CDK1 [Title/Abstract] AND NRG1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CDK1 [Title/Abstract] AND NRG1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CDK1(62539960)-NRG1(32585467), # samples:1
Anticipated loss of major functional domain due to fusion event.	CDK1-NRG1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CDK1-NRG1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CDK1-NRG1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CDK1-NRG1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CDK1	GO:0006468	protein phosphorylation	23509069\|23574715
Hgene	CDK1	GO:0018105	peptidyl-serine phosphorylation	11298763\|19879842
Hgene	CDK1	GO:0018107	peptidyl-threonine phosphorylation	11298763
Hgene	CDK1	GO:0034501	protein localization to kinetochore	18195732
Hgene	CDK1	GO:0043066	negative regulation of apoptotic process	11069302
Tgene	NRG1	GO:0003222	ventricular trabecula myocardium morphogenesis	17336907
Tgene	NRG1	GO:0031334	positive regulation of protein complex assembly	10559227
Tgene	NRG1	GO:0038127	ERBB signaling pathway	11389077
Tgene	NRG1	GO:0038129	ERBB3 signaling pathway	27353365
Tgene	NRG1	GO:0045892	negative regulation of transcription, DNA-templated	15073182
Tgene	NRG1	GO:0051048	negative regulation of secretion	10559227
Tgene	NRG1	GO:0060379	cardiac muscle cell myoblast differentiation	17336907
Tgene	NRG1	GO:0060956	endocardial cell differentiation	17336907

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:62539960/chr8:32585467)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CDK1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NRG1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000316629	CDK1	chr10	62539960	-	ENST00000519301	NRG1	chr8	32585467	+	1618	179	142	1614	490
ENST00000316629	CDK1	chr10	62539960	-	ENST00000520407	NRG1	chr8	32585467	+	859	179	12	320	102
ENST00000316629	CDK1	chr10	62539960	-	ENST00000523079	NRG1	chr8	32585467	+	1519	179	142	939	265
ENST00000316629	CDK1	chr10	62539960	-	ENST00000338921	NRG1	chr8	32585467	+	2252	179	142	1623	493
ENST00000316629	CDK1	chr10	62539960	-	ENST00000356819	NRG1	chr8	32585467	+	2243	179	142	1614	490
ENST00000316629	CDK1	chr10	62539960	-	ENST00000287845	NRG1	chr8	32585467	+	2243	179	142	1614	490
ENST00000316629	CDK1	chr10	62539960	-	ENST00000341377	NRG1	chr8	32585467	+	2287	179	420	1658	412
ENST00000316629	CDK1	chr10	62539960	-	ENST00000287842	NRG1	chr8	32585467	+	1700	179	142	1590	482
ENST00000316629	CDK1	chr10	62539960	-	ENST00000521670	NRG1	chr8	32585467	+	1338	179	142	1065	307
ENST00000316629	CDK1	chr10	62539960	-	ENST00000405005	NRG1	chr8	32585467	+	1669	179	142	1599	485
ENST00000316629	CDK1	chr10	62539960	-	ENST00000520502	NRG1	chr8	32585467	+	842	179	12	320	102
ENST00000316629	CDK1	chr10	62539960	-	ENST00000539990	NRG1	chr8	32585467	+	1697	179	142	1590	482
ENST00000395284	CDK1	chr10	62539960	-	ENST00000519301	NRG1	chr8	32585467	+	1618	179	142	1614	490
ENST00000395284	CDK1	chr10	62539960	-	ENST00000520407	NRG1	chr8	32585467	+	859	179	12	320	102
ENST00000395284	CDK1	chr10	62539960	-	ENST00000523079	NRG1	chr8	32585467	+	1519	179	142	939	265
ENST00000395284	CDK1	chr10	62539960	-	ENST00000338921	NRG1	chr8	32585467	+	2252	179	142	1623	493
ENST00000395284	CDK1	chr10	62539960	-	ENST00000356819	NRG1	chr8	32585467	+	2243	179	142	1614	490
ENST00000395284	CDK1	chr10	62539960	-	ENST00000287845	NRG1	chr8	32585467	+	2243	179	142	1614	490
ENST00000395284	CDK1	chr10	62539960	-	ENST00000341377	NRG1	chr8	32585467	+	2287	179	420	1658	412
ENST00000395284	CDK1	chr10	62539960	-	ENST00000287842	NRG1	chr8	32585467	+	1700	179	142	1590	482
ENST00000395284	CDK1	chr10	62539960	-	ENST00000521670	NRG1	chr8	32585467	+	1338	179	142	1065	307
ENST00000395284	CDK1	chr10	62539960	-	ENST00000405005	NRG1	chr8	32585467	+	1669	179	142	1599	485
ENST00000395284	CDK1	chr10	62539960	-	ENST00000520502	NRG1	chr8	32585467	+	842	179	12	320	102
ENST00000395284	CDK1	chr10	62539960	-	ENST00000539990	NRG1	chr8	32585467	+	1697	179	142	1590	482
ENST00000448257	CDK1	chr10	62539960	-	ENST00000519301	NRG1	chr8	32585467	+	1677	238	201	1673	490
ENST00000448257	CDK1	chr10	62539960	-	ENST00000520407	NRG1	chr8	32585467	+	918	238	201	461	86
ENST00000448257	CDK1	chr10	62539960	-	ENST00000523079	NRG1	chr8	32585467	+	1578	238	201	998	265
ENST00000448257	CDK1	chr10	62539960	-	ENST00000338921	NRG1	chr8	32585467	+	2311	238	201	1682	493
ENST00000448257	CDK1	chr10	62539960	-	ENST00000356819	NRG1	chr8	32585467	+	2302	238	201	1673	490
ENST00000448257	CDK1	chr10	62539960	-	ENST00000287845	NRG1	chr8	32585467	+	2302	238	201	1673	490
ENST00000448257	CDK1	chr10	62539960	-	ENST00000341377	NRG1	chr8	32585467	+	2346	238	479	1717	412
ENST00000448257	CDK1	chr10	62539960	-	ENST00000287842	NRG1	chr8	32585467	+	1759	238	201	1649	482
ENST00000448257	CDK1	chr10	62539960	-	ENST00000521670	NRG1	chr8	32585467	+	1397	238	201	1124	307
ENST00000448257	CDK1	chr10	62539960	-	ENST00000405005	NRG1	chr8	32585467	+	1728	238	201	1658	485
ENST00000448257	CDK1	chr10	62539960	-	ENST00000520502	NRG1	chr8	32585467	+	901	238	201	461	86
ENST00000448257	CDK1	chr10	62539960	-	ENST00000539990	NRG1	chr8	32585467	+	1756	238	201	1649	482
ENST00000373809	CDK1	chr10	62539960	-	ENST00000519301	NRG1	chr8	32585467	+	1489	50	13	1485	490
ENST00000373809	CDK1	chr10	62539960	-	ENST00000520407	NRG1	chr8	32585467	+	730	50	13	273	86
ENST00000373809	CDK1	chr10	62539960	-	ENST00000523079	NRG1	chr8	32585467	+	1390	50	13	810	265
ENST00000373809	CDK1	chr10	62539960	-	ENST00000338921	NRG1	chr8	32585467	+	2123	50	13	1494	493
ENST00000373809	CDK1	chr10	62539960	-	ENST00000356819	NRG1	chr8	32585467	+	2114	50	13	1485	490
ENST00000373809	CDK1	chr10	62539960	-	ENST00000287845	NRG1	chr8	32585467	+	2114	50	13	1485	490
ENST00000373809	CDK1	chr10	62539960	-	ENST00000341377	NRG1	chr8	32585467	+	2158	50	291	1529	412
ENST00000373809	CDK1	chr10	62539960	-	ENST00000287842	NRG1	chr8	32585467	+	1571	50	13	1461	482
ENST00000373809	CDK1	chr10	62539960	-	ENST00000521670	NRG1	chr8	32585467	+	1209	50	13	936	307
ENST00000373809	CDK1	chr10	62539960	-	ENST00000405005	NRG1	chr8	32585467	+	1540	50	13	1470	485
ENST00000373809	CDK1	chr10	62539960	-	ENST00000520502	NRG1	chr8	32585467	+	713	50	13	273	86
ENST00000373809	CDK1	chr10	62539960	-	ENST00000539990	NRG1	chr8	32585467	+	1568	50	13	1461	482

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000316629	ENST00000519301	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.00731029	0.99268967
ENST00000316629	ENST00000520407	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.5029475	0.4970525
ENST00000316629	ENST00000523079	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.03506162	0.9649384
ENST00000316629	ENST00000338921	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.002767893	0.99723214
ENST00000316629	ENST00000356819	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.001999782	0.9980002
ENST00000316629	ENST00000287845	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.001999782	0.9980002
ENST00000316629	ENST00000341377	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.003109179	0.99689084
ENST00000316629	ENST00000287842	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.005697317	0.99430275
ENST00000316629	ENST00000521670	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.042134006	0.95786595
ENST00000316629	ENST00000405005	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.004230952	0.995769
ENST00000316629	ENST00000520502	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.4872516	0.5127484
ENST00000316629	ENST00000539990	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.005812686	0.99418736
ENST00000395284	ENST00000519301	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.00731029	0.99268967
ENST00000395284	ENST00000520407	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.5029475	0.4970525
ENST00000395284	ENST00000523079	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.03506162	0.9649384
ENST00000395284	ENST00000338921	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.002767893	0.99723214
ENST00000395284	ENST00000356819	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.001999782	0.9980002
ENST00000395284	ENST00000287845	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.001999782	0.9980002
ENST00000395284	ENST00000341377	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.003109179	0.99689084
ENST00000395284	ENST00000287842	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.005697317	0.99430275
ENST00000395284	ENST00000521670	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.042134006	0.95786595
ENST00000395284	ENST00000405005	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.004230952	0.995769
ENST00000395284	ENST00000520502	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.4872516	0.5127484
ENST00000395284	ENST00000539990	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.005812686	0.99418736
ENST00000448257	ENST00000519301	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.005777123	0.9942228
ENST00000448257	ENST00000520407	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.2983041	0.70169586
ENST00000448257	ENST00000523079	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.023292782	0.9767072
ENST00000448257	ENST00000338921	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.002205076	0.997795
ENST00000448257	ENST00000356819	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.001514745	0.99848527
ENST00000448257	ENST00000287845	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.001514745	0.99848527
ENST00000448257	ENST00000341377	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.002355217	0.9976447
ENST00000448257	ENST00000287842	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.004935317	0.9950647
ENST00000448257	ENST00000521670	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.02976176	0.9702382
ENST00000448257	ENST00000405005	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.003492407	0.9965076
ENST00000448257	ENST00000520502	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.24362448	0.75637555
ENST00000448257	ENST00000539990	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.004980462	0.99501956
ENST00000373809	ENST00000519301	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.008702557	0.9912975
ENST00000373809	ENST00000520407	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.47772795	0.52227205
ENST00000373809	ENST00000523079	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.030514734	0.9694853
ENST00000373809	ENST00000338921	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.002848679	0.9971513
ENST00000373809	ENST00000356819	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.002055594	0.9979444
ENST00000373809	ENST00000287845	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.002055594	0.9979444
ENST00000373809	ENST00000341377	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.00319545	0.9968046
ENST00000373809	ENST00000287842	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.006709037	0.9932909
ENST00000373809	ENST00000521670	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.04782211	0.9521779
ENST00000373809	ENST00000405005	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.004884794	0.99511516
ENST00000373809	ENST00000520502	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.44064942	0.55935055
ENST00000373809	ENST00000539990	CDK1	chr10	62539960	-	NRG1	chr8	32585467	+	0.006773506	0.99322647

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CDK1-NRG1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CDK1	chr10	62539960	NRG1	chr8	32585467	179	55	NYGRLYQNRENWRSYIYIHHWDKPSC

Top

Potential FusionNeoAntigen Information of CDK1-NRG1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CDK1-NRG1_62539960_32585467.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B57:01	RSYIYIHHW	0.9998	0.9062	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B58:02	RSYIYIHHW	0.9995	0.7545	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B58:01	RSYIYIHHW	0.9994	0.7797	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B44:03	RENWRSYIY	0.9984	0.9182	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B57:03	RSYIYIHHW	0.998	0.9445	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:17	RSYIYIHHW	0.9969	0.7428	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:16	RSYIYIHHW	0.9957	0.6181	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-A32:13	RSYIYIHHW	0.9939	0.8913	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B18:01	RENWRSYIY	0.9788	0.8652	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:03	RENWRSYIY	0.1759	0.6375	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B52:01	RSYIYIHHW	0.0241	0.8367	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:01	YQNRENWRSY	0.9998	0.8314	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B27:02	WRSYIYIHHW	0.9997	0.5544	11	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B57:01	WRSYIYIHHW	0.9849	0.9307	11	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:25	YQNRENWRSY	0.981	0.8392	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:02	YQNRENWRSY	0.9589	0.8736	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:03	YQNRENWRSY	0.8345	0.7218	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-C15:04	RSYIYIHHW	0.7615	0.7472	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:07	YQNRENWRSY	0.9986	0.6733	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:04	YQNRENWRSY	0.9948	0.8167	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:21	YQNRENWRSY	0.9585	0.8617	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:05	YQNRENWRSY	0.9254	0.8307	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:31	YQNRENWRSY	0.8731	0.8439	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B57:10	RSYIYIHHW	0.9998	0.9062	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B57:04	RSYIYIHHW	0.9991	0.6012	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B58:06	RSYIYIHHW	0.9991	0.6247	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B44:07	RENWRSYIY	0.9984	0.9182	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B44:26	RENWRSYIY	0.9984	0.9182	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B44:13	RENWRSYIY	0.9984	0.9182	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-A32:01	RSYIYIHHW	0.998	0.8746	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B18:08	RENWRSYIY	0.9815	0.6678	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B57:02	RSYIYIHHW	0.9805	0.7003	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B18:05	RENWRSYIY	0.9788	0.8652	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B18:04	RENWRSYIY	0.9777	0.8824	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B18:06	RENWRSYIY	0.9741	0.8708	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B18:03	RENWRSYIY	0.9722	0.8581	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B18:11	RENWRSYIY	0.972	0.8159	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:13	RSYIYIHHW	0.9564	0.532	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-C15:09	RSYIYIHHW	0.7615	0.7472	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:24	RSYIYIHHW	0.7	0.8082	12	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B35:28	RENWRSYIY	0.558	0.8115	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:53	RENWRSYIY	0.2651	0.825	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B48:02	RENWRSYIY	0.1966	0.7961	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:54	RENWRSYIY	0.0534	0.8052	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:68	RENWRSYIY	0.0144	0.5313	8	17
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:34	YQNRENWRSY	0.9998	0.8314	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:125	YQNRENWRSY	0.9998	0.8314	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:33	YQNRENWRSY	0.9998	0.8314	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:27	YQNRENWRSY	0.9998	0.823	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:135	YQNRENWRSY	0.9998	0.8192	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:50	YQNRENWRSY	0.9996	0.8942	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:24	YQNRENWRSY	0.9992	0.7651	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:35	YQNRENWRSY	0.9987	0.8136	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:12	YQNRENWRSY	0.9974	0.8297	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:53	YQNRENWRSY	0.9966	0.8025	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:54	YQNRENWRSY	0.9936	0.7762	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B57:10	WRSYIYIHHW	0.9849	0.9307	11	21
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:39	YQNRENWRSY	0.9814	0.7786	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:68	YQNRENWRSY	0.9757	0.5461	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B15:20	YQNRENWRSY	0.9286	0.8733	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B35:28	YQNRENWRSY	0.9179	0.8837	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B35:20	YQNRENWRSY	0.8497	0.9005	5	15
CDK1-NRG1	chr10	62539960	chr8	32585467	179	HLA-B48:02	YQNRENWRSY	0.7045	0.8696	5	15

Top

Potential FusionNeoAntigen Information of CDK1-NRG1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CDK1-NRG1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7434	QNRENWRSYIYIHH	CDK1	NRG1	chr10	62539960	chr8	32585467	179

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CDK1-NRG1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7434	QNRENWRSYIYIHH	-7.15543	-7.26883
HLA-B14:02	3BVN	7434	QNRENWRSYIYIHH	-4.77435	-5.80965
HLA-B52:01	3W39	7434	QNRENWRSYIYIHH	-6.80875	-6.92215
HLA-B52:01	3W39	7434	QNRENWRSYIYIHH	-4.20386	-5.23916
HLA-A11:01	4UQ2	7434	QNRENWRSYIYIHH	-7.5194	-8.5547
HLA-A11:01	4UQ2	7434	QNRENWRSYIYIHH	-6.9601	-7.0735
HLA-A24:02	5HGA	7434	QNRENWRSYIYIHH	-7.52403	-7.63743
HLA-A24:02	5HGA	7434	QNRENWRSYIYIHH	-5.82433	-6.85963
HLA-B27:05	6PYJ	7434	QNRENWRSYIYIHH	-3.28285	-4.31815
HLA-B44:05	3DX8	7434	QNRENWRSYIYIHH	-5.91172	-6.94702
HLA-B44:05	3DX8	7434	QNRENWRSYIYIHH	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of CDK1-NRG1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CDK1-NRG1	chr10	62539960	chr8	32585467	11	21	WRSYIYIHHW	GAGAAGCTACATCTACATCCACCACTGGGA
CDK1-NRG1	chr10	62539960	chr8	32585467	12	21	RSYIYIHHW	AAGCTACATCTACATCCACCACTGGGA
CDK1-NRG1	chr10	62539960	chr8	32585467	5	15	YQNRENWRSY	CCAAAATAGAGAAAATTGGAGAAGCTACAT
CDK1-NRG1	chr10	62539960	chr8	32585467	8	17	RENWRSYIY	AGAAAATTGGAGAAGCTACATCTACAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CDK1-NRG1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	CDK1-NRG1	chr10	62539960	ENST00000316629	chr8	32585467	ENST00000520407	TCGA-FD-A5BR-01A

Top

Potential target of CAR-T therapy development for CDK1-NRG1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000287842

243_265

638.0

Transmembrane

Helical%3B Note%3DInternal signal sequence

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000341377

243_265

525.3333333333334

Transmembrane

Helical%3B Note%3DInternal signal sequence

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000356819

243_265

646.0

Transmembrane

Helical%3B Note%3DInternal signal sequence

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000405005

243_265

641.0

Transmembrane

Helical%3B Note%3DInternal signal sequence

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000519301

243_265

591.0

Transmembrane

Helical%3B Note%3DInternal signal sequence

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000520502

243_265

297.0

Transmembrane

Helical%3B Note%3DInternal signal sequence

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000521670

243_265

477.3333333333333

Transmembrane

Helical%3B Note%3DInternal signal sequence

Tgene

NRG1

chr10:62539960

chr8:32585467

ENST00000523079

243_265

421.0

Transmembrane

Helical%3B Note%3DInternal signal sequence

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CDK1-NRG1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CDK1-NRG1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	NRG1	C0036341	Schizophrenia	7	CTD_human
Tgene	NRG1	C0005586	Bipolar Disorder	5	PSYGENET
Tgene	NRG1	C0024809	Marijuana Abuse	3	PSYGENET
Tgene	NRG1	C0011570	Mental Depression	2	PSYGENET
Tgene	NRG1	C0011581	Depressive disorder	2	PSYGENET
Tgene	NRG1	C0006142	Malignant neoplasm of breast	1	CTD_human
Tgene	NRG1	C0006870	Cannabis Dependence	1	PSYGENET
Tgene	NRG1	C0007621	Neoplastic Cell Transformation	1	CTD_human
Tgene	NRG1	C0011616	Contact Dermatitis	1	CTD_human
Tgene	NRG1	C0018801	Heart failure	1	CTD_human
Tgene	NRG1	C0018802	Congestive heart failure	1	CTD_human
Tgene	NRG1	C0019569	Hirschsprung Disease	1	CTD_human
Tgene	NRG1	C0023212	Left-Sided Heart Failure	1	CTD_human
Tgene	NRG1	C0023893	Liver Cirrhosis, Experimental	1	CTD_human
Tgene	NRG1	C0024121	Lung Neoplasms	1	CTD_human
Tgene	NRG1	C0026650	Movement Disorders	1	CTD_human
Tgene	NRG1	C0027626	Neoplasm Invasiveness	1	CTD_human
Tgene	NRG1	C0030193	Pain	1	CTD_human
Tgene	NRG1	C0032460	Polycystic Ovary Syndrome	1	CTD_human
Tgene	NRG1	C0038358	Gastric ulcer	1	CTD_human
Tgene	NRG1	C0085758	Aganglionosis, Colonic	1	CTD_human
Tgene	NRG1	C0087031	Juvenile-Onset Still Disease	1	CTD_human
Tgene	NRG1	C0162351	Contact hypersensitivity	1	CTD_human
Tgene	NRG1	C0234230	Pain, Burning	1	CTD_human
Tgene	NRG1	C0234238	Ache	1	CTD_human
Tgene	NRG1	C0234254	Radiating pain	1	CTD_human
Tgene	NRG1	C0235527	Heart Failure, Right-Sided	1	CTD_human
Tgene	NRG1	C0236733	Amphetamine-Related Disorders	1	CTD_human
Tgene	NRG1	C0236804	Amphetamine Addiction	1	CTD_human
Tgene	NRG1	C0236807	Amphetamine Abuse	1	CTD_human
Tgene	NRG1	C0242379	Malignant neoplasm of lung	1	CTD_human
Tgene	NRG1	C0266487	Etat Marbre	1	CTD_human
Tgene	NRG1	C0458257	Pain, Splitting	1	CTD_human
Tgene	NRG1	C0458259	Pain, Crushing	1	CTD_human
Tgene	NRG1	C0678222	Breast Carcinoma	1	CTD_human
Tgene	NRG1	C0751407	Pain, Migratory	1	CTD_human
Tgene	NRG1	C0751408	Suffering, Physical	1	CTD_human
Tgene	NRG1	C0876994	Cardiotoxicity	1	CTD_human
Tgene	NRG1	C1136382	Sclerocystic Ovaries	1	CTD_human
Tgene	NRG1	C1257840	Aganglionosis, Rectosigmoid Colon	1	CTD_human
Tgene	NRG1	C1257931	Mammary Neoplasms, Human	1	CTD_human
Tgene	NRG1	C1458155	Mammary Neoplasms	1	CTD_human
Tgene	NRG1	C1959583	Myocardial Failure	1	CTD_human
Tgene	NRG1	C1961112	Heart Decompensation	1	CTD_human
Tgene	NRG1	C3495559	Juvenile arthritis	1	CTD_human
Tgene	NRG1	C3661523	Congenital Intestinal Aganglionosis	1	CTD_human
Tgene	NRG1	C3714758	Juvenile psoriatic arthritis	1	CTD_human
Tgene	NRG1	C4552091	Polyarthritis, Juvenile, Rheumatoid Factor Negative	1	CTD_human
Tgene	NRG1	C4704862	Polyarthritis, Juvenile, Rheumatoid Factor Positive	1	CTD_human
Tgene	NRG1	C4704874	Mammary Carcinoma, Human	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)