Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CIRBP-PKNOX1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CIRBP-PKNOX1
	FusionPDB ID: 16835
	FusionGDB2.0 ID: 16835
		Hgene	Tgene
	Gene symbol	CIRBP	PKNOX1
	Gene ID	1153	5316
	Gene name	cold inducible RNA binding protein	PBX/knotted 1 homeobox 1
	Synonyms	CIRP	PREP1\|pkonx1c
	Cytomap	19p13.3	21q22.3
	Type of gene	protein-coding	protein-coding
	Description	cold-inducible RNA-binding proteinA18 hnRNPglycine-rich RNA binding proteintesticular tissue protein Li 39	homeobox protein PKNOX1PBX/knotted homeobox 1Pbx regulating protein-1homeobox protein PREP-1human homeobox-containing protein
	Modification date	20200327	20200313
	UniProtAcc	Q14011 Main function of 5'-partner protein: FUNCTION: Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Acts as a translational activator. Seems to play an essential role in cold-induced suppression of cell proliferation. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN. Acts as a translational repressor (By similarity). Promotes assembly of stress granules (SGs), when overexpressed. {ECO:0000250, ECO:0000269\|PubMed:11574538, ECO:0000269\|PubMed:16513844}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000320936, ENST00000444172, ENST00000585630, ENST00000586472, ENST00000586773, ENST00000587323, ENST00000587896, ENST00000588030, ENST00000588090, ENST00000588230, ENST00000589235, ENST00000589660, ENST00000589686, ENST00000589710, ENST00000591935, ENST00000413636, ENST00000590188,	ENST00000607150, ENST00000291547, ENST00000432907,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 7 X 6=504	13 X 10 X 6=780
	# samples	13	15
	** MAII score	log2(13/504*10)=-1.95491211047146 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/780*10)=-2.37851162325373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CIRBP [Title/Abstract] AND PKNOX1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CIRBP [Title/Abstract] AND PKNOX1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CIRBP(1271411)-PKNOX1(44450156), # samples:1
Anticipated loss of major functional domain due to fusion event.	CIRBP-PKNOX1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CIRBP-PKNOX1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CIRBP-PKNOX1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CIRBP-PKNOX1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CIRBP-PKNOX1 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. CIRBP-PKNOX1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CIRBP	GO:0009411	response to UV	11574538
Hgene	CIRBP	GO:0045727	positive regulation of translation	11574538
Hgene	CIRBP	GO:0048255	mRNA stabilization	11574538

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:1271411/chr21:44450156)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CIRBP (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PKNOX1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000588030	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	810	525	26	601	191
ENST00000589660	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	605	320	55	396	113
ENST00000588090	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	761	476	118	552	144
ENST00000591935	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	620	335	46	411	121
ENST00000589710	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	697	412	132	488	118
ENST00000588230	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	635	350	64	426	120
ENST00000586472	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	635	350	64	426	120
ENST00000589686	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	696	411	131	487	118
ENST00000444172	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	525	240	125	316	63
ENST00000587323	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	630	345	59	421	120
ENST00000320936	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	630	345	59	421	120
ENST00000587896	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	621	336	11	412	133
ENST00000589235	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	617	332	46	408	120
ENST00000585630	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	618	333	53	409	118
ENST00000586773	CIRBP	chr19	1271411	+	ENST00000432907	PKNOX1	chr21	44450156	+	599	314	34	390	118

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000588030	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.46627837	0.5337217
ENST00000589660	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.3026048	0.6973952
ENST00000588090	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.52368414	0.47631583
ENST00000591935	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.5232948	0.4767052
ENST00000589710	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.46131095	0.538689
ENST00000588230	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.4540677	0.5459323
ENST00000586472	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.4540677	0.5459323
ENST00000589686	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.43979123	0.5602088
ENST00000444172	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.882474	0.11752604
ENST00000587323	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.45305884	0.54694116
ENST00000320936	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.45305884	0.54694116
ENST00000587896	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.4769931	0.5230069
ENST00000589235	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.43894953	0.5610505
ENST00000585630	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.3642256	0.6357744
ENST00000586773	ENST00000432907	CIRBP	chr19	1271411	+	PKNOX1	chr21	44450156	+	0.36507106	0.63492894

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CIRBP-PKNOX1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	240	39	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	314	94	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	320	89	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	332	96	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	333	94	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	335	97	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	336	109	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	345	96	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	350	96	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	411	94	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	412	94	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	476	120	RGGRGRGRGFSRGPLPTSAGWSWRTV
CIRBP	chr19	1271411	PKNOX1	chr21	44450156	525	167	RGGRGRGRGFSRGPLPTSAGWSWRTV

Top

Potential FusionNeoAntigen Information of CIRBP-PKNOX1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CIRBP-PKNOX1_1271411_44450156.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B39:06	SRGPLPTSA	0.9976	0.9378	10	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B39:24	SRGPLPTSA	0.997	0.7632	10	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:01	GPLPTSAGW	0.9293	0.8803	12	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B07:10	SRGPLPTSA	0.0279	0.6486	10	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B57:01	RGPLPTSAGW	0.999	0.9716	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B58:02	RGPLPTSAGW	0.9971	0.9747	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B58:01	RGPLPTSAGW	0.9927	0.968	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B57:03	RGPLPTSAGW	0.9619	0.9939	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B39:06	FSRGPLPTSA	0.9063	0.9228	9	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:01	RGPLPTSAGW	0.7628	0.8407	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:01	SRGPLPTSAGW	0.9772	0.6268	10	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:01	GPLPTSAGWSW	0.9751	0.8403	12	23
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B73:01	SRGPLPTSA	0.995	0.947	10	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B39:12	SRGPLPTSA	0.9947	0.8875	10	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B44:06	GPLPTSAGW	0.1052	0.6732	12	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B73:01	FSRGPLPTSA	0.9656	0.9468	9	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B44:06	RGPLPTSAGW	0.6472	0.5801	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B27:03	SRGPLPTSAGW	0.9979	0.5169	10	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B44:06	SRGPLPTSAGW	0.9821	0.5499	10	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B44:06	GPLPTSAGWSW	0.8943	0.5452	12	23
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B39:31	SRGPLPTSA	0.9954	0.8852	10	19
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B07:09	GPLPTSAGW	0.9553	0.5715	12	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B15:13	GPLPTSAGW	0.8335	0.9896	12	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:02	GPLPTSAGW	0.8232	0.8966	12	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B51:06	GPLPTSAGW	0.0324	0.9708	12	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B57:10	RGPLPTSAGW	0.999	0.9716	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B57:02	RGPLPTSAGW	0.9385	0.9762	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:02	RGPLPTSAGW	0.5071	0.8293	11	21
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:02	GPLPTSAGWSW	0.9542	0.8137	12	23
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	345	HLA-B53:02	SRGPLPTSAGW	0.8889	0.6467	10	21

Top

Potential FusionNeoAntigen Information of CIRBP-PKNOX1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CIRBP-PKNOX1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3079	GRGFSRGPLPTSAG	CIRBP	PKNOX1	chr19	1271411	chr21	44450156	345

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CIRBP-PKNOX1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3079	GRGFSRGPLPTSAG	-5.16857	-5.28197
HLA-B14:02	3BVN	3079	GRGFSRGPLPTSAG	-4.21097	-5.24627
HLA-B52:01	3W39	3079	GRGFSRGPLPTSAG	-4.32839	-4.44179
HLA-B52:01	3W39	3079	GRGFSRGPLPTSAG	-4.10962	-5.14492
HLA-A24:02	5HGA	3079	GRGFSRGPLPTSAG	-6.03661	-6.15001
HLA-A24:02	5HGA	3079	GRGFSRGPLPTSAG	-5.99594	-7.03124
HLA-B44:05	3DX8	3079	GRGFSRGPLPTSAG	-6.27779	-6.39119
HLA-B44:05	3DX8	3079	GRGFSRGPLPTSAG	-4.76488	-5.80018

Top

Vaccine Design for the FusionNeoAntigens of CIRBP-PKNOX1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	10	19	SRGPLPTSA	TCTCTAGAGGGCCCCTGCCCACATCAG
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	10	21	SRGPLPTSAGW	TCTCTAGAGGGCCCCTGCCCACATCAGCGGGCT
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	11	21	RGPLPTSAGW	CTAGAGGGCCCCTGCCCACATCAGCGGGCT
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	12	21	GPLPTSAGW	GAGGGCCCCTGCCCACATCAGCGGGCT
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	12	23	GPLPTSAGWSW	GAGGGCCCCTGCCCACATCAGCGGGCTGGTCTT
CIRBP-PKNOX1	chr19	1271411	chr21	44450156	9	19	FSRGPLPTSA	GGTTCTCTAGAGGGCCCCTGCCCACATCAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CIRBP-PKNOX1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	CIRBP-PKNOX1	chr19	1271411	ENST00000320936	chr21	44450156	ENST00000432907	DA500684

Top

Potential target of CAR-T therapy development for CIRBP-PKNOX1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CIRBP-PKNOX1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CIRBP-PKNOX1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)