Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CLCN3-SMAD1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CLCN3-SMAD1
	FusionPDB ID: 16988
	FusionGDB2.0 ID: 16988
		Hgene	Tgene
	Gene symbol	CLCN3	SMAD1
	Gene ID	1182	4086
	Gene name	chloride voltage-gated channel 3	SMAD family member 1
	Synonyms	CLC3\|ClC-3	BSP-1\|BSP1\|JV4-1\|JV41\|MADH1\|MADR1
	Cytomap	4q33	4q31.21
	Type of gene	protein-coding	protein-coding
	Description	H(+)/Cl(-) exchange transporter 3chloride channel 3chloride channel protein 3chloride channel, voltage-sensitive 3chloride transporter ClC-3	mothers against decapentaplegic homolog 1MAD, mothers against decapentaplegic homolog 1Mad-related protein 1SMAD, mothers against DPP homolog 1TGF-beta signaling protein 1mothers against DPP homolog 1transforming growth factor-beta signaling protein
	Modification date	20200313	20200322
	UniProtAcc	P51790 Main function of 5'-partner protein: FUNCTION: [Isoform 1]: Strongly outwardly rectifying, electrogenic H(+)/Cl(-)exchanger which mediates the exchange of chloride ions against protons (By similarity). The CLC channel family contains both chloride channels and proton-coupled anion transporters that exchange chloride or another anion for protons (PubMed:29845874). The presence of conserved gating glutamate residues is typical for family members that function as antiporters (PubMed:29845874). {ECO:0000250\|UniProtKB:P51791, ECO:0000303\|PubMed:29845874}.; FUNCTION: [Isoform 2]: Strongly outwardly rectifying, electrogenic H(+)/Cl(-)exchanger which mediates the exchange of chloride ions against protons. {ECO:0000269\|PubMed:11967229}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000506924, ENST00000347613, ENST00000360642, ENST00000504131, ENST00000513761,	ENST00000302085, ENST00000394092, ENST00000515385, ENST00000515527,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 9 X 6=702	6 X 6 X 6=216
	# samples	16	7
	** MAII score	log2(16/702*10)=-2.1333991254172 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/216*10)=-1.6256044852185 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CLCN3 [Title/Abstract] AND SMAD1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CLCN3 [Title/Abstract] AND SMAD1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CLCN3(170557239)-SMAD1(146474936), # samples:3
Anticipated loss of major functional domain due to fusion event.	CLCN3-SMAD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CLCN3-SMAD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CLCN3-SMAD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CLCN3-SMAD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CLCN3-SMAD1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. CLCN3-SMAD1 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CLCN3	GO:1902476	chloride transmembrane transport	11274166
Tgene	SMAD1	GO:0007183	SMAD protein complex assembly	9111321
Tgene	SMAD1	GO:0010628	positive regulation of gene expression	19664780
Tgene	SMAD1	GO:0030509	BMP signaling pathway	8653785\|9389648\|18548003
Tgene	SMAD1	GO:0045944	positive regulation of transcription by RNA polymerase II	12270938

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:170557239/chr4:146474936)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CLCN3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SMAD1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000513761	CLCN3	chr4	170557239	+	ENST00000302085	SMAD1	chr4	146474936	+	1265	719	559	1119	186
ENST00000347613	CLCN3	chr4	170557239	+	ENST00000302085	SMAD1	chr4	146474936	+	1260	714	554	1114	186
ENST00000360642	CLCN3	chr4	170557239	+	ENST00000302085	SMAD1	chr4	146474936	+	1257	711	551	1111	186
ENST00000513761	CLCN3	chr4	170557239	+	ENST00000302085	SMAD1	chr4	146474935	+	1265	719	559	1119	186
ENST00000347613	CLCN3	chr4	170557239	+	ENST00000302085	SMAD1	chr4	146474935	+	1260	714	554	1114	186
ENST00000360642	CLCN3	chr4	170557239	+	ENST00000302085	SMAD1	chr4	146474935	+	1257	711	551	1111	186

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000513761	ENST00000302085	CLCN3	chr4	170557239	+	SMAD1	chr4	146474936	+	0.002772464	0.9972275
ENST00000347613	ENST00000302085	CLCN3	chr4	170557239	+	SMAD1	chr4	146474936	+	0.00284571	0.99715424
ENST00000360642	ENST00000302085	CLCN3	chr4	170557239	+	SMAD1	chr4	146474936	+	0.003487722	0.99651223
ENST00000513761	ENST00000302085	CLCN3	chr4	170557239	+	SMAD1	chr4	146474935	+	0.002772464	0.9972275
ENST00000347613	ENST00000302085	CLCN3	chr4	170557239	+	SMAD1	chr4	146474935	+	0.00284571	0.99715424
ENST00000360642	ENST00000302085	CLCN3	chr4	170557239	+	SMAD1	chr4	146474935	+	0.003487722	0.99651223

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CLCN3-SMAD1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CLCN3	chr4	170557239	SMAD1	chr4	146474935	711	53	SEDDNLLDGDTAVGVHLYYVGGEVYA
CLCN3	chr4	170557239	SMAD1	chr4	146474935	714	53	SEDDNLLDGDTAVGVHLYYVGGEVYA
CLCN3	chr4	170557239	SMAD1	chr4	146474935	719	53	SEDDNLLDGDTAVGVHLYYVGGEVYA
CLCN3	chr4	170557239	SMAD1	chr4	146474936	711	53	SEDDNLLDGDTAVGVHLYYVGGEVYA
CLCN3	chr4	170557239	SMAD1	chr4	146474936	714	53	SEDDNLLDGDTAVGVHLYYVGGEVYA
CLCN3	chr4	170557239	SMAD1	chr4	146474936	719	53	SEDDNLLDGDTAVGVHLYYVGGEVYA

Top

Potential FusionNeoAntigen Information of CLCN3-SMAD1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CLCN3-SMAD1_170557239_146474935.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:01	TAVGVHLY	0.9983	0.9676	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:05	TAVGVHLY	0.9978	0.8475	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A80:01	AVGVHLYY	0.9957	0.553	11	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:25	TAVGVHLYY	0.9997	0.9832	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:08	TAVGVHLYY	0.9995	0.964	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:02	TAVGVHLYY	0.9992	0.9855	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:01	TAVGVHLYY	0.999	0.9607	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:17	TAVGVHLYY	0.9978	0.9814	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B58:01	TAVGVHLYY	0.9919	0.9862	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:16	TAVGVHLYY	0.9911	0.9727	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B58:02	TAVGVHLYY	0.989	0.9779	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:05	TAVGVHLYY	0.989	0.8164	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:01	TAVGVHLYY	0.9887	0.9713	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B53:01	TAVGVHLYY	0.9841	0.552	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:08	DTAVGVHLY	0.9798	0.9318	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:03	TAVGVHLYY	0.9722	0.9517	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:21	AVGVHLYYV	0.9713	0.8321	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B46:01	TAVGVHLYY	0.9601	0.5291	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:11	AVGVHLYYV	0.9545	0.7699	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:60	AVGVHLYYV	0.9538	0.6683	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:30	AVGVHLYYV	0.9533	0.751	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:67	AVGVHLYYV	0.9533	0.751	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:24	AVGVHLYYV	0.9533	0.751	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:29	AVGVHLYYV	0.9473	0.7543	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:01	DTAVGVHLY	0.9455	0.9209	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:35	AVGVHLYYV	0.9437	0.7837	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:27	AVGVHLYYV	0.942	0.7193	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:20	AVGVHLYYV	0.9415	0.7592	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:16	AVGVHLYYV	0.9389	0.7393	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:04	AVGVHLYYV	0.9246	0.722	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:02	DTAVGVHLY	0.813	0.9652	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:60	LLDGDTAVGV	0.9948	0.5466	5	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:35	LLDGDTAVGV	0.9448	0.5519	5	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:60	NLLDGDTAVGV	0.997	0.7299	4	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:67	NLLDGDTAVGV	0.9968	0.6931	4	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:24	NLLDGDTAVGV	0.9968	0.6931	4	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:30	NLLDGDTAVGV	0.9968	0.6931	4	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:19	NLLDGDTAVGV	0.9795	0.7935	4	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:29	NLLDGDTAVGV	0.9537	0.6925	4	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C15:04	TAVGVHLY	0.9987	0.9761	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:05	TAVGVHLYY	0.9994	0.9591	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:21	TAVGVHLYY	0.9991	0.9717	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:31	TAVGVHLYY	0.9987	0.9633	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:07	TAVGVHLYY	0.9817	0.7344	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:31	DTAVGVHLY	0.959	0.9155	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C15:04	TAVGVHLYY	0.9568	0.9676	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:01	AVGVHLYYV	0.9533	0.751	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:07	AVGVHLYYV	0.953	0.7591	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C07:95	TAVGVHLYY	0.9386	0.853	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C07:19	TAVGVHLYY	0.9302	0.8385	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C07:10	TAVGVHLYY	0.9046	0.9679	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C07:27	TAVGVHLYY	0.8698	0.9749	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C12:16	TAVGVHLYY	0.8485	0.9716	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C03:14	TAVGVHLYY	0.7744	0.9861	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C12:12	TAVGVHLYY	0.407	0.9182	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C06:03	TAVGVHLYY	0.2528	0.9944	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C12:04	TAVGVHLYY	0.2497	0.9954	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:07	LLDGDTAVGV	0.9944	0.5745	5	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:01	NLLDGDTAVGV	0.9968	0.6931	4	15
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:11	TAVGVHLY	0.9991	0.9778	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:17	TAVGVHLY	0.9991	0.9396	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:30	TAVGVHLY	0.9991	0.9396	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C15:09	TAVGVHLY	0.9987	0.9761	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:23	TAVGVHLY	0.9983	0.9703	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:77	TAVGVHLY	0.9983	0.9676	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:24	TAVGVHLY	0.9952	0.9604	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:43	TAVGVHLY	0.9925	0.9659	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C03:02	TAVGVHLY	0.992	0.9897	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C16:02	TAVGVHLY	0.9796	0.9968	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C16:04	TAVGVHLY	0.9674	0.9852	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C12:02	TAVGVHLY	0.9597	0.9818	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C16:01	TAVGVHLY	0.942	0.9896	10	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:39	TAVGVHLYY	0.9996	0.9644	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:20	TAVGVHLYY	0.9994	0.9745	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:28	TAVGVHLYY	0.9992	0.9762	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:11	TAVGVHLYY	0.9992	0.9709	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:23	TAVGVHLYY	0.999	0.964	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:77	TAVGVHLYY	0.999	0.9607	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:20	TAVGVHLYY	0.9989	0.978	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A25:01	DTAVGVHLY	0.9982	0.9396	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:30	TAVGVHLYY	0.9982	0.9242	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:17	TAVGVHLYY	0.9982	0.9242	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:13	TAVGVHLYY	0.9958	0.9336	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B58:06	TAVGVHLYY	0.9921	0.971	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:27	TAVGVHLYY	0.9898	0.9725	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:24	TAVGVHLYY	0.9891	0.951	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:34	TAVGVHLYY	0.9887	0.9713	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:125	TAVGVHLYY	0.9887	0.9713	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:33	TAVGVHLYY	0.9887	0.9713	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:135	TAVGVHLYY	0.9881	0.972	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:11	TAVGVHLYY	0.9846	0.9552	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:08	TAVGVHLYY	0.9819	0.9517	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:50	TAVGVHLYY	0.9802	0.9673	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:43	TAVGVHLYY	0.9781	0.9529	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:14	AVGVHLYYV	0.9718	0.7157	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A02:06	AVGVHLYYV	0.9713	0.8321	11	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B48:02	TAVGVHLYY	0.9684	0.9714	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:24	DTAVGVHLY	0.9663	0.9053	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C03:02	TAVGVHLYY	0.9606	0.9867	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:35	TAVGVHLYY	0.9577	0.9631	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C07:22	TAVGVHLYY	0.9571	0.8296	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C15:09	TAVGVHLYY	0.9568	0.9676	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:20	DTAVGVHLY	0.946	0.95	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:77	DTAVGVHLY	0.9455	0.9209	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:23	DTAVGVHLY	0.9453	0.9237	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C07:01	TAVGVHLYY	0.933	0.8516	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:12	TAVGVHLYY	0.9248	0.9504	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C07:17	TAVGVHLYY	0.9239	0.9724	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B53:02	TAVGVHLYY	0.9007	0.507	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C16:04	TAVGVHLYY	0.8638	0.9805	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:11	DTAVGVHLY	0.8374	0.9355	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A25:01	TAVGVHLYY	0.8089	0.8157	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C12:02	TAVGVHLYY	0.7453	0.9748	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B18:04	DTAVGVHLY	0.7242	0.9251	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B18:04	TAVGVHLYY	0.5703	0.9557	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C16:01	TAVGVHLYY	0.5403	0.9858	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C12:03	TAVGVHLYY	0.4154	0.9802	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:13	DTAVGVHLY	0.4058	0.9182	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B18:07	DTAVGVHLY	0.3614	0.8837	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C16:02	TAVGVHLYY	0.3095	0.9956	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:08	DTAVGVHLY	0.2906	0.9075	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B15:11	DTAVGVHLY	0.2821	0.9139	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:43	DTAVGVHLY	0.2167	0.9097	9	18
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B18:07	TAVGVHLYY	0.2148	0.9101	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B18:08	TAVGVHLYY	0.1901	0.7368	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C02:02	TAVGVHLYY	0.0226	0.9897	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-C02:10	TAVGVHLYY	0.0226	0.9897	10	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A68:02	TAVGVHLYYV	0.9983	0.6406	10	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A69:01	TAVGVHLYYV	0.9968	0.8651	10	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A25:01	DTAVGVHLYY	0.9963	0.9009	9	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-B35:24	DTAVGVHLYY	0.9548	0.8396	9	19
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A68:02	DTAVGVHLYYV	0.9994	0.5422	9	20
CLCN3-SMAD1	chr4	170557239	chr4	146474935	714	HLA-A25:01	DGDTAVGVHLY	0.9297	0.8699	7	18

Top

Potential FusionNeoAntigen Information of CLCN3-SMAD1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CLCN3-SMAD1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4840	LDGDTAVGVHLYYV	CLCN3	SMAD1	chr4	170557239	chr4	146474935	714

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CLCN3-SMAD1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	4840	LDGDTAVGVHLYYV	-6.65674	-6.65674
HLA-B44:05	3DX8	4840	LDGDTAVGVHLYYV	-6.36866	-6.36866

Top

Vaccine Design for the FusionNeoAntigens of CLCN3-SMAD1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CLCN3-SMAD1	chr4	170557239	chr4	146474935	10	18	TAVGVHLY	CTGCAGTTGGAGTTCATCTTTATT
CLCN3-SMAD1	chr4	170557239	chr4	146474935	10	19	TAVGVHLYY	CTGCAGTTGGAGTTCATCTTTATTATG
CLCN3-SMAD1	chr4	170557239	chr4	146474935	10	20	TAVGVHLYYV	CTGCAGTTGGAGTTCATCTTTATTATGTTG
CLCN3-SMAD1	chr4	170557239	chr4	146474935	11	19	AVGVHLYY	CAGTTGGAGTTCATCTTTATTATG
CLCN3-SMAD1	chr4	170557239	chr4	146474935	11	20	AVGVHLYYV	CAGTTGGAGTTCATCTTTATTATGTTG
CLCN3-SMAD1	chr4	170557239	chr4	146474935	4	15	NLLDGDTAVGV	ATTTATTAGATGGTGACACTGCAGTTGGAGTTC
CLCN3-SMAD1	chr4	170557239	chr4	146474935	5	15	LLDGDTAVGV	TATTAGATGGTGACACTGCAGTTGGAGTTC
CLCN3-SMAD1	chr4	170557239	chr4	146474935	7	18	DGDTAVGVHLY	ATGGTGACACTGCAGTTGGAGTTCATCTTTATT
CLCN3-SMAD1	chr4	170557239	chr4	146474935	9	18	DTAVGVHLY	ACACTGCAGTTGGAGTTCATCTTTATT
CLCN3-SMAD1	chr4	170557239	chr4	146474935	9	19	DTAVGVHLYY	ACACTGCAGTTGGAGTTCATCTTTATTATG
CLCN3-SMAD1	chr4	170557239	chr4	146474935	9	20	DTAVGVHLYYV	ACACTGCAGTTGGAGTTCATCTTTATTATGTTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CLCN3-SMAD1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	CLCN3-SMAD1	chr4	170557239	ENST00000347613	chr4	146474935	ENST00000302085	TCGA-AN-A04C

Top

Potential target of CAR-T therapy development for CLCN3-SMAD1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CLCN3-SMAD1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CLCN3-SMAD1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)