Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CLK2-CD244

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CLK2-CD244
	FusionPDB ID: 17203
	FusionGDB2.0 ID: 17203
		Hgene	Tgene
	Gene symbol	CLK2	CD244
	Gene ID	9894	51744
	Gene name	telomere maintenance 2	CD244 molecule
	Synonyms	CLK2\|TEL2\|YHFS	2B4\|NAIL\|NKR2B4\|Nmrk\|SLAMF4
	Cytomap	16p13.3	1q23.3
	Type of gene	protein-coding	protein-coding
	Description	telomere length regulation protein TEL2 homologTEL2, telomere maintenance 2, homologprotein clk-2 homolog	natural killer cell receptor 2B4CD244 molecule, natural killer cell receptor 2B4NK cell activation inducing ligand NAILNK cell activation-inducing ligandNK cell type I receptor protein 2B4SLAM family member 4h2B4signaling lymphocytic activation mol
	Modification date	20200313	20200313
	UniProtAcc	P49760 Main function of 5'-partner protein: FUNCTION: Dual specificity kinase acting on both serine/threonine and tyrosine-containing substrates. Phosphorylates serine- and arginine-rich (SR) proteins of the spliceosomal complex. May be a constituent of a network of regulatory mechanisms that enable SR proteins to control RNA splicing and can cause redistribution of SR proteins from speckles to a diffuse nucleoplasmic distribution. Acts as a suppressor of hepatic gluconeogenesis and glucose output by repressing PPARGC1A transcriptional activity on gluconeogenic genes via its phosphorylation. Phosphorylates PPP2R5B thereby stimulating the assembly of PP2A phosphatase with the PPP2R5B-AKT1 complex leading to dephosphorylation of AKT1. Phosphorylates: PTPN1, SRSF1 and SRSF3. Regulates the alternative splicing of tissue factor (F3) pre-mRNA in endothelial cells. Phosphorylates PAGE4 at several serine and threonine residues and this phosphorylation attenuates the ability of PAGE4 to potentiate the transcriptional activator activity of JUN (PubMed:28289210). {ECO:0000269\|PubMed:10480872, ECO:0000269\|PubMed:19168442, ECO:0000269\|PubMed:28289210, ECO:0000269\|PubMed:8910305, ECO:0000269\|PubMed:9637771}.	Q9BZW8 Main function of 5'-partner protein: FUNCTION: Heterophilic receptor of the signaling lymphocytic activation molecule (SLAM) family; its ligand is CD48. SLAM receptors triggered by homo- or heterotypic cell-cell interactions are modulating the activation and differentiation of a wide variety of immune cells and thus are involved in the regulation and interconnection of both innate and adaptive immune response. Activities are controlled by presence or absence of small cytoplasmic adapter proteins, SH2D1A/SAP and/or SH2D1B/EAT-2. Acts as activating natural killer (NK) cell receptor (PubMed:10359122, PubMed:8376943, PubMed:11714776). Activating function implicates association with SH2D1A and FYN (PubMed:15713798). Downstreaming signaling involves predominantly VAV1, and, to a lesser degree, INPP5D/SHIP1 and CBL. Signal attenuation in the absence of SH2D1A is proposed to be dependent on INPP5D and to a lesser extent PTPN6/SHP-1 and PTPN11/SHP-2 (PubMed:10934222, PubMed:15713798). Stimulates NK cell cytotoxicity, production of IFN-gamma and granule exocytosis (PubMed:8376943, PubMed:11714776). Optimal expansion and activation of NK cells seems to be dependent on the engagement of CD244 with CD48 expressed on neighboring NK cells (By similarity). Acts as costimulator in NK activation by enhancing signals by other NK receptors such as NCR3 and NCR1 (PubMed:10741393). At early stages of NK cell differentiation may function as an inhibitory receptor possibly ensuring the self-tolerance of developing NK cells (PubMed:11917118). Involved in the regulation of CD8(+) T-cell proliferation; expression on activated T-cells and binding to CD488 provides costimulatory-like function for neighboring T-cells (By similarity). Inhibits inflammatory responses in dendritic cells (DCs) (By similarity). {ECO:0000250\|UniProtKB:Q07763, ECO:0000269\|PubMed:10359122, ECO:0000269\|PubMed:10741393, ECO:0000269\|PubMed:10934222, ECO:0000269\|PubMed:11714776, ECO:0000269\|PubMed:11917118, ECO:0000269\|PubMed:8376943, ECO:0000305\|PubMed:15713798}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000355560, ENST00000361168, ENST00000368361, ENST00000536801, ENST00000497188,	ENST00000481677, ENST00000322302, ENST00000368032, ENST00000368033, ENST00000368034,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 6 X 5=150	3 X 2 X 3=18
	# samples	6	4
	** MAII score	log2(6/150*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/18*10)=1.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: CLK2 [Title/Abstract] AND CD244 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CLK2 [Title/Abstract] AND CD244 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CLK2(155239279)-CD244(160808839), # samples:3
Anticipated loss of major functional domain due to fusion event.	CLK2-CD244 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CLK2-CD244 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CLK2-CD244 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CLK2-CD244 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CLK2-CD244 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. CLK2-CD244 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. CLK2-CD244 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	CD244	GO:0002323	natural killer cell activation involved in immune response	11714776
Tgene	CD244	GO:0060732	positive regulation of inositol phosphate biosynthetic process	8376943
Tgene	CD244	GO:0071663	positive regulation of granzyme B production	11714776
Tgene	CD244	GO:1902715	positive regulation of interferon-gamma secretion	11714776
Tgene	CD244	GO:2000484	positive regulation of interleukin-8 secretion	8376943

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:155239279/chr1:160808839)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CLK2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CD244 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000536801	CLK2	chr1	155239279	-	ENST00000368034	CD244	chr1	160808839	-	2202	572	105	917	270
ENST00000536801	CLK2	chr1	155239279	-	ENST00000368033	CD244	chr1	160808839	-	1179	572	105	917	270
ENST00000536801	CLK2	chr1	155239279	-	ENST00000322302	CD244	chr1	160808839	-	1091	572	105	917	270
ENST00000536801	CLK2	chr1	155239279	-	ENST00000368032	CD244	chr1	160808839	-	907	572	105	881	258
ENST00000536801	CLK2	chr1	155239278	-	ENST00000368034	CD244	chr1	160808839	-	2202	572	105	917	270
ENST00000536801	CLK2	chr1	155239278	-	ENST00000368033	CD244	chr1	160808839	-	1179	572	105	917	270
ENST00000536801	CLK2	chr1	155239278	-	ENST00000322302	CD244	chr1	160808839	-	1091	572	105	917	270
ENST00000536801	CLK2	chr1	155239278	-	ENST00000368032	CD244	chr1	160808839	-	907	572	105	881	258

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000536801	ENST00000368034	CLK2	chr1	155239279	-	CD244	chr1	160808839	-	0.007236757	0.9927632
ENST00000536801	ENST00000368033	CLK2	chr1	155239279	-	CD244	chr1	160808839	-	0.002177089	0.9978229
ENST00000536801	ENST00000322302	CLK2	chr1	155239279	-	CD244	chr1	160808839	-	0.001846806	0.99815315
ENST00000536801	ENST00000368032	CLK2	chr1	155239279	-	CD244	chr1	160808839	-	0.001578551	0.99842143
ENST00000536801	ENST00000368034	CLK2	chr1	155239278	-	CD244	chr1	160808839	-	0.007236757	0.9927632
ENST00000536801	ENST00000368033	CLK2	chr1	155239278	-	CD244	chr1	160808839	-	0.002177089	0.9978229
ENST00000536801	ENST00000322302	CLK2	chr1	155239278	-	CD244	chr1	160808839	-	0.001846806	0.99815315
ENST00000536801	ENST00000368032	CLK2	chr1	155239278	-	CD244	chr1	160808839	-	0.001578551	0.99842143

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CLK2-CD244

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CLK2	chr1	155239278	CD244	chr1	160808839	572	154	DGGGGAAGHLAAHLRIQILAVFGDHR
CLK2	chr1	155239279	CD244	chr1	160808839	572	154	DGGGGAAGHLAAHLRIQILAVFGDHR

Top

Potential FusionNeoAntigen Information of CLK2-CD244 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CLK2-CD244_155239278_160808839.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:01	AHLRIQIL	0.9993	0.899	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B14:02	AHLRIQIL	0.9989	0.6453	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B14:01	AHLRIQIL	0.9989	0.6453	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B38:02	AHLRIQIL	0.9983	0.9595	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B38:01	AHLRIQIL	0.9982	0.9523	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B15:10	AHLRIQIL	0.9976	0.5635	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B15:37	AHLRIQIL	0.9925	0.5306	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:01	AAHLRIQIL	0.9988	0.7136	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:06	AHLRIQILA	0.9981	0.7784	11	20
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:09	AAHLRIQIL	0.9977	0.7408	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B51:01	LAAHLRIQI	0.9973	0.6222	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B51:02	LAAHLRIQI	0.997	0.5212	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:24	GHLAAHLRI	0.9922	0.6677	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:01	GHLAAHLRI	0.9909	0.9526	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B14:01	AAHLRIQIL	0.9904	0.9045	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B14:02	AAHLRIQIL	0.9904	0.9045	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B38:01	GHLAAHLRI	0.9857	0.9844	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B38:02	GHLAAHLRI	0.9823	0.9842	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:09	HLRIQILAV	0.9773	0.8132	12	21
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:01	HLRIQILAV	0.9735	0.5819	12	21
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-A02:13	HLRIQILAV	0.9565	0.7147	12	21
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B52:01	AAHLRIQIL	0.756	0.9552	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B15:10	GHLAAHLRI	0.6361	0.5599	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:05	HLRIQILAVF	0.9978	0.8349	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:02	HLRIQILAVF	0.9977	0.6406	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:04	HLRIQILAVF	0.9975	0.7461	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:07	HLRIQILAVF	0.9773	0.514	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:02	AHLRIQILAVF	0.9955	0.601	11	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:07	AHLRIQILAVF	0.9954	0.5719	11	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:09	AHLRIQIL	0.9993	0.6151	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:12	AHLRIQIL	0.999	0.9061	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:05	AHLRIQIL	0.998	0.8885	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B14:03	AHLRIQIL	0.879	0.721	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:04	AAHLRIQIL	0.9993	0.9297	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B42:02	AAHLRIQIL	0.9992	0.7194	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:06	LAAHLRIQI	0.9992	0.9462	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:19	AAHLRIQIL	0.9989	0.9859	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B42:01	AAHLRIQIL	0.9988	0.7108	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:08	AAHLRIQIL	0.9988	0.9056	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:06	AAHLRIQIL	0.9987	0.9471	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:07	AAHLRIQIL	0.9984	0.9819	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C12:12	AAHLRIQIL	0.9906	0.9627	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C12:04	LAAHLRIQI	0.9903	0.995	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C06:03	LAAHLRIQI	0.9902	0.9958	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C12:12	LAAHLRIQI	0.9867	0.9733	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C06:03	AAHLRIQIL	0.9864	0.9957	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C12:04	AAHLRIQIL	0.9823	0.9956	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B39:05	GHLAAHLRI	0.9815	0.946	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C02:06	LAAHLRIQI	0.9756	0.9873	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B51:08	LAAHLRIQI	0.9739	0.6289	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C08:04	AAHLRIQIL	0.9447	0.9735	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C08:13	AAHLRIQIL	0.9447	0.9735	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C02:06	AAHLRIQIL	0.9344	0.9808	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B73:01	AHLRIQILA	0.831	0.7421	11	20
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B14:03	AAHLRIQIL	0.8271	0.9292	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:14	AAHLRIQIL	0.8182	0.9809	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B15:04	HLRIQILAV	0.7433	0.8984	12	21
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C01:30	AAHLRIQIL	0.6735	0.9787	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C08:03	AAHLRIQIL	0.6725	0.9893	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C01:17	AAHLRIQIL	0.534	0.9731	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:03	HLRIQILAVF	0.9343	0.8427	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:03	AHLRIQILAVF	0.9449	0.8191	11	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B38:05	AHLRIQIL	0.9982	0.9523	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B15:09	AHLRIQIL	0.9922	0.5747	11	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:09	AAHLRIQIL	0.9993	0.9297	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:02	LAAHLRIQI	0.9992	0.9339	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:05	LAAHLRIQI	0.9992	0.9465	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:18	AAHLRIQIL	0.9988	0.7136	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:17	LAAHLRIQI	0.9988	0.975	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:04	AAHLRIQIL	0.9986	0.9837	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:03	AAHLRIQIL	0.9986	0.9837	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:05	AAHLRIQIL	0.9984	0.9492	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C15:02	AAHLRIQIL	0.9983	0.9235	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:17	AAHLRIQIL	0.9983	0.9636	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:05	AAHLRIQIL	0.9981	0.9122	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C16:04	AAHLRIQIL	0.9972	0.9893	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B51:14	LAAHLRIQI	0.9971	0.6268	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:67	AAHLRIQIL	0.997	0.9762	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:02	AAHLRIQIL	0.9964	0.9684	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B51:21	LAAHLRIQI	0.9957	0.6369	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-A02:03	HLRIQILAV	0.9952	0.709	12	21
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C16:04	LAAHLRIQI	0.9924	0.99	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C16:02	LAAHLRIQI	0.9914	0.9939	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C12:03	AAHLRIQIL	0.9905	0.9876	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C06:17	AAHLRIQIL	0.9879	0.9954	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B51:09	LAAHLRIQI	0.9879	0.6315	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C06:02	AAHLRIQIL	0.9879	0.9954	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B38:05	GHLAAHLRI	0.9857	0.9844	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C12:02	AAHLRIQIL	0.9819	0.9762	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:12	AAHLRIQIL	0.9793	0.861	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C12:03	LAAHLRIQI	0.9774	0.9871	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C07:04	AAHLRIQIL	0.9758	0.983	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:18	HLRIQILAV	0.9735	0.5819	12	21
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C16:01	AAHLRIQIL	0.9684	0.9858	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C03:06	AAHLRIQIL	0.9684	0.9861	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C16:02	AAHLRIQIL	0.9671	0.9941	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B07:13	AAHLRIQIL	0.9494	0.8706	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C16:01	LAAHLRIQI	0.9324	0.9842	9	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C06:08	AAHLRIQIL	0.9153	0.9941	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C02:10	AAHLRIQIL	0.904	0.9869	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C02:02	AAHLRIQIL	0.904	0.9869	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C06:06	AAHLRIQIL	0.9018	0.9939	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B35:13	AAHLRIQIL	0.8067	0.9298	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B08:12	HLRIQILAV	0.6875	0.7727	12	21
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C08:01	AAHLRIQIL	0.6725	0.9893	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B15:09	GHLAAHLRI	0.6119	0.9213	7	16
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C01:02	AAHLRIQIL	0.5275	0.9726	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-C17:01	AAHLRIQIL	0.3652	0.9523	10	19
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:10	HLRIQILAVF	0.9977	0.8651	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:08	HLRIQILAVF	0.9967	0.7846	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-A02:03	HLAAHLRIQI	0.996	0.7545	8	18
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:06	HLRIQILAVF	0.992	0.7306	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:09	HLRIQILAVF	0.9837	0.8191	12	22
CLK2-CD244	chr1	155239278	chr1	160808839	572	HLA-B27:08	AHLRIQILAVF	0.9965	0.7528	11	22

Top

Potential FusionNeoAntigen Information of CLK2-CD244 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CLK2-CD244

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
228	AGHLAAHLRIQILA	CLK2	CD244	chr1	155239278	chr1	160808839	572

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CLK2-CD244

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	228	AGHLAAHLRIQILA	-7.9962	-8.1096
HLA-B14:02	3BVN	228	AGHLAAHLRIQILA	-5.70842	-6.74372
HLA-B52:01	3W39	228	AGHLAAHLRIQILA	-6.83737	-6.95077
HLA-B52:01	3W39	228	AGHLAAHLRIQILA	-4.4836	-5.5189
HLA-A11:01	4UQ2	228	AGHLAAHLRIQILA	-10.0067	-10.1201
HLA-A11:01	4UQ2	228	AGHLAAHLRIQILA	-9.03915	-10.0745
HLA-A24:02	5HGA	228	AGHLAAHLRIQILA	-6.56204	-6.67544
HLA-A24:02	5HGA	228	AGHLAAHLRIQILA	-5.42271	-6.45801
HLA-B44:05	3DX8	228	AGHLAAHLRIQILA	-7.85648	-8.89178
HLA-B44:05	3DX8	228	AGHLAAHLRIQILA	-5.3978	-5.5112
HLA-A02:01	6TDR	228	AGHLAAHLRIQILA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of CLK2-CD244

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CLK2-CD244	chr1	155239278	chr1	160808839	10	19	AAHLRIQIL	TCATCTTCGAATTCAGATTTTGGCCGT
CLK2-CD244	chr1	155239278	chr1	160808839	11	19	AHLRIQIL	TCTTCGAATTCAGATTTTGGCCGT
CLK2-CD244	chr1	155239278	chr1	160808839	11	20	AHLRIQILA	TCTTCGAATTCAGATTTTGGCCGTTTT
CLK2-CD244	chr1	155239278	chr1	160808839	11	22	AHLRIQILAVF	TCTTCGAATTCAGATTTTGGCCGTTTTTGGTGA
CLK2-CD244	chr1	155239278	chr1	160808839	12	21	HLRIQILAV	TCGAATTCAGATTTTGGCCGTTTTTGG
CLK2-CD244	chr1	155239278	chr1	160808839	12	22	HLRIQILAVF	TCGAATTCAGATTTTGGCCGTTTTTGGTGA
CLK2-CD244	chr1	155239278	chr1	160808839	7	16	GHLAAHLRI	TTTAGCCGCTCATCTTCGAATTCAGAT
CLK2-CD244	chr1	155239278	chr1	160808839	8	18	HLAAHLRIQI	AGCCGCTCATCTTCGAATTCAGATTTTGGC
CLK2-CD244	chr1	155239278	chr1	160808839	9	18	LAAHLRIQI	CGCTCATCTTCGAATTCAGATTTTGGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CLK2-CD244

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	CLK2-CD244	chr1	155239278	ENST00000536801	chr1	160808839	ENST00000322302	TCGA-AC-A62V

Top

Potential target of CAR-T therapy development for CLK2-CD244

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

CD244

chr1:155239278

chr1:160808839

ENST00000322302

230_250

274.0

Transmembrane

Helical

Tgene

CD244

chr1:155239278

chr1:160808839

ENST00000368032

230_250

330.0

Transmembrane

Helical

Tgene

CD244

chr1:155239278

chr1:160808839

ENST00000368033

230_250

371.0

Transmembrane

Helical

Tgene

CD244

chr1:155239278

chr1:160808839

ENST00000368034

230_250

366.0

Transmembrane

Helical

Tgene

CD244

chr1:155239279

chr1:160808839

ENST00000322302

230_250

274.0

Transmembrane

Helical

Tgene

CD244

chr1:155239279

chr1:160808839

ENST00000368032

230_250

330.0

Transmembrane

Helical

Tgene

CD244

chr1:155239279

chr1:160808839

ENST00000368033

230_250

371.0

Transmembrane

Helical

Tgene

CD244

chr1:155239279

chr1:160808839

ENST00000368034

230_250

366.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CLK2-CD244

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CLK2-CD244

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)