Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CLPTM1-CBLC

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CLPTM1-CBLC
	FusionPDB ID: 17302
	FusionGDB2.0 ID: 17302
		Hgene	Tgene
	Gene symbol	CLPTM1	CBLC
	Gene ID	1209	23624
	Gene name	CLPTM1 regulator of GABA type A receptor forward trafficking	Cbl proto-oncogene C
	Synonyms	-	CBL-3\|CBL-SL\|RNF57
	Cytomap	19q13.32	19q13.32
	Type of gene	protein-coding	protein-coding
	Description	cleft lip and palate transmembrane protein 1CLPTM1, transmembrane proteincleft lip and palate associated transmembrane protein 1	E3 ubiquitin-protein ligase CBL-CCas-Br-M (murine) ecotropic retroviral transforming sequence cCas-Br-M (murine) ectropic retroviral transforming sequence cCbl proto-oncogene C, E3 ubiquitin protein ligaseCbl proto-oncogene, E3 ubiquitin protein ligas
	Modification date	20200313	20200313
	UniProtAcc	Q96KA5 Main function of 5'-partner protein: FUNCTION: Enhances cisplatin-mediated apoptosis, when overexpressed. {ECO:0000269\|PubMed:11162647}.	Q9ULV8 Main function of 5'-partner protein: FUNCTION: Acts as an E3 ubiquitin-protein ligase, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes, and then transfers it to substrates promoting their degradation by the proteasome. Functionally coupled with the E2 ubiquitin-protein ligases UB2D1, UB2D2 and UB2D3. Regulator of EGFR mediated signal transduction; upon EGF activation, ubiquitinates EGFR. Isoform 1, but not isoform 2, inhibits EGF stimulated MAPK1 activation. Promotes ubiquitination of SRC phosphorylated at 'Tyr-419'. In collaboration with CD2AP may act as regulatory checkpoint for Ret signaling by modulating the rate of RET degradation after ligand activation; CD2AP converts it from an inhibitor to a promoter of RET degradation; the function limits the potency of GDNF on neuronal survival. {ECO:0000269\|PubMed:10362357, ECO:0000269\|PubMed:14661060, ECO:0000269\|PubMed:18753381, ECO:0000269\|PubMed:20525694, ECO:0000269\|PubMed:23145173}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000546079, ENST00000337392, ENST00000541297, ENST00000589158,	ENST00000270279, ENST00000341505,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	16 X 12 X 8=1536	4 X 7 X 2=56
	# samples	20	7
	** MAII score	log2(20/1536*10)=-2.94110631094643 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/56*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: CLPTM1 [Title/Abstract] AND CBLC [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CLPTM1 [Title/Abstract] AND CBLC [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CLPTM1(45465332)-CBLC(45293261), # samples:2
Anticipated loss of major functional domain due to fusion event.	CLPTM1-CBLC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CLPTM1-CBLC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CLPTM1-CBLC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CLPTM1-CBLC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	CBLC	GO:0006511	ubiquitin-dependent protein catabolic process	14661060
Tgene	CBLC	GO:0007175	negative regulation of epidermal growth factor-activated receptor activity	10362357
Tgene	CBLC	GO:0016567	protein ubiquitination	14661060
Tgene	CBLC	GO:0042059	negative regulation of epidermal growth factor receptor signaling pathway	10362357
Tgene	CBLC	GO:0043407	negative regulation of MAP kinase activity	10362357

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:45465332/chr19:45293261)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CLPTM1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CBLC (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000541297	CLPTM1	chr19	45465332	+	ENST00000341505	CBLC	chr19	45293260	+	1207	608	465	1115	216
ENST00000541297	CLPTM1	chr19	45465332	+	ENST00000270279	CBLC	chr19	45293260	+	1207	608	465	1115	216
ENST00000337392	CLPTM1	chr19	45465332	+	ENST00000341505	CBLC	chr19	45293260	+	934	335	87	842	251
ENST00000337392	CLPTM1	chr19	45465332	+	ENST00000270279	CBLC	chr19	45293260	+	934	335	87	842	251
ENST00000541297	CLPTM1	chr19	45465332	+	ENST00000341505	CBLC	chr19	45293261	+	1207	608	465	1115	216
ENST00000541297	CLPTM1	chr19	45465332	+	ENST00000270279	CBLC	chr19	45293261	+	1207	608	465	1115	216
ENST00000337392	CLPTM1	chr19	45465332	+	ENST00000341505	CBLC	chr19	45293261	+	934	335	87	842	251
ENST00000337392	CLPTM1	chr19	45465332	+	ENST00000270279	CBLC	chr19	45293261	+	934	335	87	842	251

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000541297	ENST00000341505	CLPTM1	chr19	45465332	+	CBLC	chr19	45293260	+	0.04266494	0.95733505
ENST00000541297	ENST00000270279	CLPTM1	chr19	45465332	+	CBLC	chr19	45293260	+	0.04266494	0.95733505
ENST00000337392	ENST00000341505	CLPTM1	chr19	45465332	+	CBLC	chr19	45293260	+	0.031086847	0.9689132
ENST00000337392	ENST00000270279	CLPTM1	chr19	45465332	+	CBLC	chr19	45293260	+	0.031086847	0.9689132
ENST00000541297	ENST00000341505	CLPTM1	chr19	45465332	+	CBLC	chr19	45293261	+	0.04266494	0.95733505
ENST00000541297	ENST00000270279	CLPTM1	chr19	45465332	+	CBLC	chr19	45293261	+	0.04266494	0.95733505
ENST00000337392	ENST00000341505	CLPTM1	chr19	45465332	+	CBLC	chr19	45293261	+	0.031086847	0.9689132
ENST00000337392	ENST00000270279	CLPTM1	chr19	45465332	+	CBLC	chr19	45293261	+	0.031086847	0.9689132

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CLPTM1-CBLC

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CLPTM1	chr19	45465332	CBLC	chr19	45293260	335	82	APNAWQVIKGVLFSYLYPDGKTHNPD
CLPTM1	chr19	45465332	CBLC	chr19	45293260	608	47	APNAWQVIKGVLFSYLYPDGKTHNPD
CLPTM1	chr19	45465332	CBLC	chr19	45293261	335	82	APNAWQVIKGVLFSYLYPDGKTHNPD
CLPTM1	chr19	45465332	CBLC	chr19	45293261	608	47	APNAWQVIKGVLFSYLYPDGKTHNPD

Top

Potential FusionNeoAntigen Information of CLPTM1-CBLC in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CLPTM1-CBLC_45465332_45293260.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:01	VIKGVLFSY	0.9997	0.8042	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:25	VIKGVLFSY	0.9985	0.8112	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:02	VIKGVLFSY	0.9963	0.819	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-A32:13	VIKGVLFSY	0.6316	0.7214	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:01	QVIKGVLFSY	0.9997	0.8453	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:25	QVIKGVLFSY	0.9986	0.8799	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:02	QVIKGVLFSY	0.9966	0.8946	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:21	VIKGVLFSY	0.9947	0.7864	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:05	VIKGVLFSY	0.9615	0.7442	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:04	VIKGVLFSY	0.9431	0.7881	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:31	VIKGVLFSY	0.9142	0.7641	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-C15:04	VIKGVLFSY	0.7329	0.8866	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:07	QVIKGVLFSY	0.9993	0.5912	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:05	QVIKGVLFSY	0.9903	0.8807	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:31	QVIKGVLFSY	0.9802	0.8908	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:07	WQVIKGVLFSY	0.998	0.6782	4	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:125	VIKGVLFSY	0.9997	0.8042	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:27	VIKGVLFSY	0.9997	0.8187	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:33	VIKGVLFSY	0.9997	0.8042	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:34	VIKGVLFSY	0.9997	0.8042	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:135	VIKGVLFSY	0.9996	0.7982	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:50	VIKGVLFSY	0.9996	0.8712	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:35	VIKGVLFSY	0.9994	0.6824	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:11	VIKGVLFSY	0.9993	0.7518	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:08	VIKGVLFSY	0.9991	0.7461	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B35:43	VIKGVLFSY	0.9989	0.7332	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:24	VIKGVLFSY	0.9985	0.6779	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:39	VIKGVLFSY	0.9984	0.6363	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:12	VIKGVLFSY	0.9901	0.7422	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:20	VIKGVLFSY	0.9661	0.8366	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B35:28	VIKGVLFSY	0.9346	0.8325	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B35:30	VIKGVLFSY	0.9193	0.5514	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B35:17	VIKGVLFSY	0.9193	0.5514	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B35:20	VIKGVLFSY	0.9147	0.8418	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-C12:02	VIKGVLFSY	0.8873	0.936	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-A32:01	VIKGVLFSY	0.866	0.6942	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-C15:09	VIKGVLFSY	0.7329	0.8866	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-A25:01	VIKGVLFSY	0.4691	0.6329	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-C02:10	VIKGVLFSY	0.0872	0.9551	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-C02:02	VIKGVLFSY	0.0872	0.9551	6	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:50	QVIKGVLFSY	0.9997	0.905	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:135	QVIKGVLFSY	0.9997	0.8447	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:33	QVIKGVLFSY	0.9997	0.8453	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:34	QVIKGVLFSY	0.9997	0.8453	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:125	QVIKGVLFSY	0.9997	0.8453	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:27	QVIKGVLFSY	0.9997	0.8603	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:35	QVIKGVLFSY	0.9993	0.7923	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:08	QVIKGVLFSY	0.9993	0.7851	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:11	QVIKGVLFSY	0.9993	0.7895	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:12	QVIKGVLFSY	0.9988	0.8458	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:39	QVIKGVLFSY	0.9983	0.7532	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:20	QVIKGVLFSY	0.9917	0.925	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-A25:01	QVIKGVLFSY	0.9488	0.7068	5	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	HLA-B15:35	WQVIKGVLFSY	0.9981	0.8772	4	15

Top

Potential FusionNeoAntigen Information of CLPTM1-CBLC in HLA II

CLPTM1-CBLC_45465332_45293260.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	DRB1-1222	APNAWQVIKGVLFSY	0	15
CLPTM1-CBLC	chr19	45465332	chr19	45293260	335	DRB1-1222	PNAWQVIKGVLFSYL	1	16

Top

Fusion breakpoint peptide structures of CLPTM1-CBLC

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10015	VIKGVLFSYLYPDG	CLPTM1	CBLC	chr19	45465332	chr19	45293260	335

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CLPTM1-CBLC

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10015	VIKGVLFSYLYPDG	-7.9962	-8.1096
HLA-B14:02	3BVN	10015	VIKGVLFSYLYPDG	-5.70842	-6.74372
HLA-B52:01	3W39	10015	VIKGVLFSYLYPDG	-6.83737	-6.95077
HLA-B52:01	3W39	10015	VIKGVLFSYLYPDG	-4.4836	-5.5189
HLA-A11:01	4UQ2	10015	VIKGVLFSYLYPDG	-10.0067	-10.1201
HLA-A11:01	4UQ2	10015	VIKGVLFSYLYPDG	-9.03915	-10.0745
HLA-A24:02	5HGA	10015	VIKGVLFSYLYPDG	-6.56204	-6.67544
HLA-A24:02	5HGA	10015	VIKGVLFSYLYPDG	-5.42271	-6.45801
HLA-B44:05	3DX8	10015	VIKGVLFSYLYPDG	-7.85648	-8.89178
HLA-B44:05	3DX8	10015	VIKGVLFSYLYPDG	-5.3978	-5.5112
HLA-B35:01	1A1N	10015	VIKGVLFSYLYPDG	-6.27422	-6.38762
HLA-B35:01	1A1N	10015	VIKGVLFSYLYPDG	-5.27424	-6.30954
HLA-A02:01	6TDR	10015	VIKGVLFSYLYPDG	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of CLPTM1-CBLC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CLPTM1-CBLC	chr19	45465332	chr19	45293260	4	15	WQVIKGVLFSY	GCAGGTCATCAAAGGTGTGCTGTTTAGCTACCT
CLPTM1-CBLC	chr19	45465332	chr19	45293260	5	15	QVIKGVLFSY	GGTCATCAAAGGTGTGCTGTTTAGCTACCT
CLPTM1-CBLC	chr19	45465332	chr19	45293260	6	15	VIKGVLFSY	CATCAAAGGTGTGCTGTTTAGCTACCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CLPTM1-CBLC	chr19	45465332	chr19	45293260	0	15	APNAWQVIKGVLFSY	ACCCAATGCCTGGCAGGTCATCAAAGGTGTGCTGTTTAGCTACCT
CLPTM1-CBLC	chr19	45465332	chr19	45293260	1	16	PNAWQVIKGVLFSYL	CAATGCCTGGCAGGTCATCAAAGGTGTGCTGTTTAGCTACCTCTA

Top

Information of the samples that have these potential fusion neoantigens of CLPTM1-CBLC

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	CLPTM1-CBLC	chr19	45465332	ENST00000337392	chr19	45293260	ENST00000270279	TCGA-VQ-A8P3

Top

Potential target of CAR-T therapy development for CLPTM1-CBLC

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CLPTM1-CBLC

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CLPTM1-CBLC

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)