Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ACTN1-PHACTR4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ACTN1-PHACTR4
	FusionPDB ID: 1747
	FusionGDB2.0 ID: 1747
		Hgene	Tgene
	Gene symbol	ACTN1	PHACTR4
	Gene ID	87	65979
	Gene name	actinin alpha 1	phosphatase and actin regulator 4
	Synonyms	BDPLT15	PPP1R124
	Cytomap	14q24.1\|14q22-q24	1p35.3
	Type of gene	protein-coding	protein-coding
	Description	alpha-actinin-1F-actin cross-linking proteinactinin 1 smooth musclealpha-actinin cytoskeletal isoformepididymis secretory sperm binding proteinnon-muscle alpha-actinin-1	phosphatase and actin regulator 4protein phosphatase 1, regulatory subunit 124
	Modification date	20200327	20200313
	UniProtAcc	P12814 Main function of 5'-partner protein: FUNCTION: F-actin cross-linking protein which is thought to anchor actin to a variety of intracellular structures. This is a bundling protein.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000193403, ENST00000376839, ENST00000394419, ENST00000438964, ENST00000538545, ENST00000554508,	ENST00000373836, ENST00000493669, ENST00000373839,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 14 X 4=784	7 X 7 X 5=245
	# samples	17	8
	** MAII score	log2(17/784*10)=-2.20531890797751 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/245*10)=-1.61470984411521 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ACTN1 [Title/Abstract] AND PHACTR4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ACTN1 [Title/Abstract] AND PHACTR4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ACTN1(69387723)-PHACTR4(28800066), # samples:1
Anticipated loss of major functional domain due to fusion event.	ACTN1-PHACTR4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ACTN1-PHACTR4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ACTN1-PHACTR4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ACTN1-PHACTR4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:69387723/chr1:28800066)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ACTN1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PHACTR4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000193403	ACTN1	chr14	69387723	-	ENST00000373839	PHACTR4	chr1	28800066	+	5830	724	384	2009	541
ENST00000394419	ACTN1	chr14	69387723	-	ENST00000373839	PHACTR4	chr1	28800066	+	5629	523	183	1808	541
ENST00000438964	ACTN1	chr14	69387723	-	ENST00000373839	PHACTR4	chr1	28800066	+	5652	546	206	1831	541
ENST00000376839	ACTN1	chr14	69387723	-	ENST00000373839	PHACTR4	chr1	28800066	+	5530	424	270	1709	479
ENST00000538545	ACTN1	chr14	69387723	-	ENST00000373839	PHACTR4	chr1	28800066	+	5466	360	20	1645	541

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000193403	ENST00000373839	ACTN1	chr14	69387723	-	PHACTR4	chr1	28800066	+	0.002591697	0.99740833
ENST00000394419	ENST00000373839	ACTN1	chr14	69387723	-	PHACTR4	chr1	28800066	+	0.002359571	0.9976405
ENST00000438964	ENST00000373839	ACTN1	chr14	69387723	-	PHACTR4	chr1	28800066	+	0.00243424	0.99756575
ENST00000376839	ENST00000373839	ACTN1	chr14	69387723	-	PHACTR4	chr1	28800066	+	0.000931561	0.99906844
ENST00000538545	ENST00000373839	ACTN1	chr14	69387723	-	PHACTR4	chr1	28800066	+	0.002002899	0.9979971

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ACTN1-PHACTR4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ACTN1	chr14	69387723	PHACTR4	chr1	28800066	360	113	ASKGVKLVSIGAEAELSQAINSGTLL
ACTN1	chr14	69387723	PHACTR4	chr1	28800066	424	51	ASKGVKLVSIGAEAELSQAINSGTLL
ACTN1	chr14	69387723	PHACTR4	chr1	28800066	523	113	ASKGVKLVSIGAEAELSQAINSGTLL
ACTN1	chr14	69387723	PHACTR4	chr1	28800066	546	113	ASKGVKLVSIGAEAELSQAINSGTLL
ACTN1	chr14	69387723	PHACTR4	chr1	28800066	724	113	ASKGVKLVSIGAEAELSQAINSGTLL

Top

Potential FusionNeoAntigen Information of ACTN1-PHACTR4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ACTN1-PHACTR4_69387723_28800066.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:02	AEAELSQA	0.9997	0.8075	11	19
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B45:01	AEAELSQA	0.9996	0.9667	11	19
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B51:01	EAELSQAI	0.9963	0.7841	12	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B41:01	AEAELSQA	0.9636	0.9571	11	19
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:01	AEAELSQA	0.9523	0.9671	11	19
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B13:02	AEAELSQAI	0.9993	0.7653	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:02	AEAELSQAI	0.9991	0.73	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B13:01	AEAELSQAI	0.9988	0.9883	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B45:01	AEAELSQAI	0.9955	0.9768	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:03	AEAELSQAI	0.9943	0.9883	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-A02:13	KLVSIGAEA	0.9789	0.5626	5	14
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B47:01	AEAELSQAI	0.9774	0.7536	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B48:01	AEAELSQAI	0.9713	0.6536	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B18:01	AEAELSQAI	0.5681	0.8989	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B41:01	AEAELSQAI	0.455	0.9885	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B39:13	AEAELSQAI	0.4097	0.9884	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:01	AEAELSQAI	0.3633	0.8339	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B52:01	AEAELSQAI	0.1083	0.9917	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:05	GAEAELSQAI	0.4851	0.872	10	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:01	GAEAELSQAI	0.3447	0.8484	10	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:06	AEAELSQA	0.9999	0.9516	11	19
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B51:08	EAELSQAI	0.9838	0.6751	12	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:06	AEAELSQAI	0.9998	0.7701	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:07	VSIGAEAEL	0.9997	0.9899	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:19	VSIGAEAEL	0.9996	0.994	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:08	VSIGAEAEL	0.9994	0.8984	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C15:06	VSIGAEAEL	0.9993	0.9367	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:10	AEAELSQAI	0.9987	0.7322	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:09	AEAELSQAI	0.99	0.5204	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C08:04	VSIGAEAEL	0.9899	0.9661	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C08:13	VSIGAEAEL	0.9899	0.9661	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C08:03	VSIGAEAEL	0.8571	0.9868	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C02:06	VSIGAEAEL	0.7398	0.9668	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B39:08	AEAELSQAI	0.6932	0.9602	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B39:05	AEAELSQAI	0.3116	0.9738	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B51:07	AEAELSQAI	0.0881	0.966	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:10	GAEAELSQAI	0.4234	0.9784	10	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B51:13	EAELSQAI	0.9961	0.5923	12	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B51:14	EAELSQAI	0.9946	0.7034	12	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B51:21	EAELSQAI	0.9944	0.7021	12	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B51:29	EAELSQAI	0.9671	0.5808	12	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:04	AEAELSQA	0.9523	0.9671	11	19
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:05	AEAELSQA	0.9523	0.9671	11	19
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:03	VSIGAEAEL	0.9997	0.994	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:04	VSIGAEAEL	0.9997	0.994	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:04	AEAELSQAI	0.9994	0.7741	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:17	VSIGAEAEL	0.9993	0.9823	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:05	VSIGAEAEL	0.9993	0.9398	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C15:05	VSIGAEAEL	0.9992	0.8914	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:21	AEAELSQAI	0.9979	0.5549	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C03:06	VSIGAEAEL	0.9943	0.9948	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:13	AEAELSQAI	0.9943	0.9883	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:07	AEAELSQAI	0.9943	0.9883	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B44:26	AEAELSQAI	0.9943	0.9883	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-A02:03	KLVSIGAEA	0.9926	0.5324	5	14
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C08:01	VSIGAEAEL	0.8571	0.9868	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B35:13	VSIGAEAEL	0.7649	0.9556	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B39:11	AEAELSQAI	0.6681	0.9391	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B41:03	AEAELSQAI	0.6506	0.8584	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B18:11	AEAELSQAI	0.6072	0.8842	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B18:05	AEAELSQAI	0.5681	0.8989	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B18:03	AEAELSQAI	0.4959	0.8928	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-C17:01	VSIGAEAEL	0.4838	0.8448	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B18:06	AEAELSQAI	0.4668	0.9197	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B39:31	AEAELSQAI	0.3803	0.9771	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:05	AEAELSQAI	0.3633	0.8339	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B50:04	AEAELSQAI	0.3633	0.8339	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B39:02	AEAELSQAI	0.3423	0.9882	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B48:02	AEAELSQAI	0.303	0.9206	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B07:13	VSIGAEAEL	0.1242	0.7696	7	16
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B15:53	AEAELSQAI	0.0526	0.9408	11	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:04	GAEAELSQAI	0.407	0.8962	10	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B41:03	GAEAELSQAI	0.343	0.9323	10	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:49	GAEAELSQAI	0.3365	0.8632	10	20
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	724	HLA-B40:36	GAEAELSQAI	0.3182	0.8485	10	20

Top

Potential FusionNeoAntigen Information of ACTN1-PHACTR4 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ACTN1-PHACTR4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5794	LVSIGAEAELSQAI	ACTN1	PHACTR4	chr14	69387723	chr1	28800066	724

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ACTN1-PHACTR4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5794	LVSIGAEAELSQAI	-7.15543	-7.26883
HLA-B14:02	3BVN	5794	LVSIGAEAELSQAI	-4.77435	-5.80965
HLA-B52:01	3W39	5794	LVSIGAEAELSQAI	-6.80875	-6.92215
HLA-B52:01	3W39	5794	LVSIGAEAELSQAI	-4.20386	-5.23916
HLA-A11:01	4UQ2	5794	LVSIGAEAELSQAI	-7.5194	-8.5547
HLA-A11:01	4UQ2	5794	LVSIGAEAELSQAI	-6.9601	-7.0735
HLA-A24:02	5HGA	5794	LVSIGAEAELSQAI	-7.52403	-7.63743
HLA-A24:02	5HGA	5794	LVSIGAEAELSQAI	-5.82433	-6.85963
HLA-B27:05	6PYJ	5794	LVSIGAEAELSQAI	-3.28285	-4.31815
HLA-B44:05	3DX8	5794	LVSIGAEAELSQAI	-5.91172	-6.94702
HLA-B44:05	3DX8	5794	LVSIGAEAELSQAI	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ACTN1-PHACTR4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	10	20	GAEAELSQAI	GAGCCGAAGCTGAACTGTCCCAAGCAATAA
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	11	19	AEAELSQA	CCGAAGCTGAACTGTCCCAAGCAA
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	11	20	AEAELSQAI	CCGAAGCTGAACTGTCCCAAGCAATAA
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	12	20	EAELSQAI	AAGCTGAACTGTCCCAAGCAATAA
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	5	14	KLVSIGAEA	AACTGGTGTCCATCGGAGCCGAAGCTG
ACTN1-PHACTR4	chr14	69387723	chr1	28800066	7	16	VSIGAEAEL	TGTCCATCGGAGCCGAAGCTGAACTGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ACTN1-PHACTR4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ACTN1-PHACTR4	chr14	69387723	ENST00000193403	chr1	28800066	ENST00000373839	TCGA-BR-8365-01A

Top

Potential target of CAR-T therapy development for ACTN1-PHACTR4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ACTN1-PHACTR4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ACTN1-PHACTR4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)