Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CPD-MYL4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CPD-MYL4
	FusionPDB ID: 18931
	FusionGDB2.0 ID: 18931
		Hgene	Tgene
	Gene symbol	CPD	MYL4
	Gene ID	9455	4635
	Gene name	homer scaffold protein 2	myosin light chain 4
	Synonyms	ACPD\|CPD\|DFNA68\|HOMER-2\|VESL-2	ALC1\|AMLC\|GT1\|PRO1957
	Cytomap	15q25.2	17q21.32
	Type of gene	protein-coding	protein-coding
	Description	homer protein homolog 2cupidinhomer homolog 2homer homolog 3homer scaffolding protein 2homer, neuronal immediate early gene, 2	myosin light chain 4atrial myosin light chain 1myosin light chain 1, embryonic muscle/atrial isoformmyosin light chain alkali GT-1 isoformmyosin, atrial/fetal muscle, light chainmyosin, light chain 4, alkali; atrial, embryonicmyosin, light polypepti
	Modification date	20200313	20200313
	UniProtAcc	O75976 Main function of 5'-partner protein:	P12829 Main function of 5'-partner protein: FUNCTION: Regulatory light chain of myosin. Does not bind calcium.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000225719, ENST00000543464, ENST00000584051,	ENST00000354968, ENST00000393450, ENST00000572316,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	26 X 16 X 10=4160	9 X 5 X 7=315
	# samples	26	15
	** MAII score	log2(26/4160*10)=-4 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/315*10)=-1.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CPD [Title/Abstract] AND MYL4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CPD [Title/Abstract] AND MYL4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CPD(28712254)-MYL4(45286755), # samples:2
Anticipated loss of major functional domain due to fusion event.	CPD-MYL4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CPD-MYL4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CPD-MYL4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CPD-MYL4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:28712254/chr17:45286755)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CPD (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MYL4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000225719	CPD	chr17	28712254	+	ENST00000572316	MYL4	chr17	45297270	+	1666	1070	76	1500	474
ENST00000225719	CPD	chr17	28712254	+	ENST00000354968	MYL4	chr17	45297270	+	1686	1070	76	1500	474
ENST00000225719	CPD	chr17	28712254	+	ENST00000393450	MYL4	chr17	45297270	+	1687	1070	76	1500	474
ENST00000543464	CPD	chr17	28712254	+	ENST00000572316	MYL4	chr17	45297270	+	1251	655	402	1085	227
ENST00000543464	CPD	chr17	28712254	+	ENST00000354968	MYL4	chr17	45297270	+	1271	655	402	1085	227
ENST00000543464	CPD	chr17	28712254	+	ENST00000393450	MYL4	chr17	45297270	+	1272	655	402	1085	227

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000225719	ENST00000572316	CPD	chr17	28712254	+	MYL4	chr17	45297270	+	0.005638507	0.9943615
ENST00000225719	ENST00000354968	CPD	chr17	28712254	+	MYL4	chr17	45297270	+	0.005961269	0.9940387
ENST00000225719	ENST00000393450	CPD	chr17	28712254	+	MYL4	chr17	45297270	+	0.006007052	0.993993
ENST00000543464	ENST00000572316	CPD	chr17	28712254	+	MYL4	chr17	45297270	+	0.001353985	0.9986461
ENST00000543464	ENST00000354968	CPD	chr17	28712254	+	MYL4	chr17	45297270	+	0.001524895	0.99847513
ENST00000543464	ENST00000393450	CPD	chr17	28712254	+	MYL4	chr17	45297270	+	0.00152358	0.99847645

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CPD-MYL4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CPD	chr17	28712254	MYL4	chr17	45297270	1070	331	DGITNGAHWYDVEEFKEAFSLFDRTP
CPD	chr17	28712254	MYL4	chr17	45297270	655	84	DGITNGAHWYDVEEFKEAFSLFDRTP

Top

Potential FusionNeoAntigen Information of CPD-MYL4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CPD-MYL4_28712254_45297270.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:01	VEEFKEAF	0.9975	0.9863	11	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:03	EEFKEAFSL	0.9956	0.9819	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B13:01	EEFKEAFSL	0.9951	0.9366	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B50:02	EEFKEAFSL	0.99	0.6188	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B14:02	EEFKEAFSL	0.9897	0.5978	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B14:01	EEFKEAFSL	0.9897	0.5978	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B47:01	EEFKEAFSL	0.9877	0.711	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:01	EEFKEAFSL	0.9876	0.9482	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B45:01	EEFKEAFSL	0.985	0.9535	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B35:08	DVEEFKEAF	0.9701	0.9088	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B35:01	DVEEFKEAF	0.9688	0.9644	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:01	AHWYDVEEF	0.9644	0.9531	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:02	AHWYDVEEF	0.9347	0.9825	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:01	AHWYDVEEF	0.9288	0.9827	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:10	AHWYDVEEF	0.8144	0.7386	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:18	AHWYDVEEF	0.7249	0.915	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:13	EEFKEAFSL	0.7145	0.9336	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:02	EEFKEAFSL	0.7096	0.9749	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:01	EEFKEAFSL	0.6986	0.962	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:01	EEFKEAFSL	0.6877	0.969	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B41:01	EEFKEAFSL	0.5831	0.9487	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:03	AHWYDVEEF	0.5646	0.9476	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:37	EEFKEAFSL	0.5426	0.7126	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:10	EEFKEAFSL	0.3566	0.699	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:37	AHWYDVEEF	0.2585	0.7846	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:03	EEFKEAFSLF	0.9994	0.9845	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:01	EEFKEAFSLF	0.9946	0.9132	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:01	GAHWYDVEEF	0.2788	0.974	5	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:01	NGAHWYDVEEF	0.6174	0.9593	4	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B40:06	EEFKEAFSL	0.9996	0.6013	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:09	AHWYDVEEF	0.9696	0.6271	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:31	DVEEFKEAF	0.9501	0.9586	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:05	AHWYDVEEF	0.9215	0.9466	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:08	EEFKEAFSL	0.7628	0.8872	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:09	EEFKEAFSL	0.7438	0.6323	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:05	EEFKEAFSL	0.7053	0.9588	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:12	EEFKEAFSL	0.6616	0.9724	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B51:07	EEFKEAFSL	0.145	0.7038	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:10	EEFKEAFSLF	0.9827	0.6118	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:06	VEEFKEAF	0.9983	0.9881	11	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:08	VEEFKEAF	0.9977	0.9785	11	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:05	VEEFKEAF	0.9975	0.9863	11	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:03	VEEFKEAF	0.9962	0.9854	11	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:11	VEEFKEAF	0.996	0.9715	11	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-C14:03	HWYDVEEF	0.9734	0.9674	7	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-C14:02	HWYDVEEF	0.9734	0.9674	7	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B40:04	EEFKEAFSL	0.9991	0.7477	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:13	EEFKEAFSL	0.9956	0.9819	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:26	EEFKEAFSL	0.9956	0.9819	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:07	EEFKEAFSL	0.9956	0.9819	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-A25:01	DVEEFKEAF	0.995	0.7534	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:04	EEFKEAFSL	0.9923	0.9533	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:07	EEFKEAFSL	0.9901	0.9205	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B35:24	DVEEFKEAF	0.9879	0.9809	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:08	EEFKEAFSL	0.9877	0.9136	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:05	EEFKEAFSL	0.9876	0.9482	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:06	EEFKEAFSL	0.9854	0.953	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:03	EEFKEAFSL	0.978	0.9431	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B35:77	DVEEFKEAF	0.9688	0.9644	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B35:23	DVEEFKEAF	0.9677	0.9653	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:31	AHWYDVEEF	0.9653	0.9534	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:11	EEFKEAFSL	0.9555	0.9411	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B35:20	DVEEFKEAF	0.9543	0.9746	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:05	AHWYDVEEF	0.9288	0.9827	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:04	DVEEFKEAF	0.9162	0.9765	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B41:03	EEFKEAFSL	0.8051	0.7051	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:07	DVEEFKEAF	0.7979	0.9513	10	19
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B15:09	AHWYDVEEF	0.7343	0.92	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:11	EEFKEAFSL	0.7189	0.885	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:31	EEFKEAFSL	0.7186	0.9687	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:02	EEFKEAFSL	0.716	0.9426	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:05	EEFKEAFSL	0.6986	0.962	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B48:02	AHWYDVEEF	0.6934	0.9811	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B35:20	EEFKEAFSL	0.422	0.9541	12	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B39:11	AHWYDVEEF	0.4082	0.8813	6	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:13	EEFKEAFSLF	0.9994	0.9845	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:26	EEFKEAFSLF	0.9994	0.9845	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B44:07	EEFKEAFSLF	0.9994	0.9845	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:04	EEFKEAFSLF	0.9971	0.9217	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B40:04	VEEFKEAFSL	0.9965	0.7506	11	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:07	EEFKEAFSLF	0.9961	0.8884	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:06	EEFKEAFSLF	0.9956	0.9185	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:08	EEFKEAFSLF	0.9948	0.8925	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:05	EEFKEAFSLF	0.9946	0.9132	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:11	EEFKEAFSLF	0.9914	0.9241	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:03	EEFKEAFSLF	0.9891	0.9079	12	22
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:05	GAHWYDVEEF	0.2788	0.974	5	15
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B18:03	DVEEFKEAFSL	0.9705	0.9545	10	21
CPD-MYL4	chr17	28712254	chr17	45297270	1070	HLA-B38:05	NGAHWYDVEEF	0.6174	0.9593	4	15

Top

Potential FusionNeoAntigen Information of CPD-MYL4 in HLA II

CPD-MYL4_28712254_45297270.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0405	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0405	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0407	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0409	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0417	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0417	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0424	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0424	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0429	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0429	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0430	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0430	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0445	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0445	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0448	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0448	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0457	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0457	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0469	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0469	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0477	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0477	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0480	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0483	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0483	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0484	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0484	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0486	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0486	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0487	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0489	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0489	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0901	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0903	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0908	VEEFKEAFSLFDRTP	11	26
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0908	DVEEFKEAFSLFDRT	10	25
CPD-MYL4	chr17	28712254	chr17	45297270	1070	DRB1-0909	VEEFKEAFSLFDRTP	11	26

Top

Fusion breakpoint peptide structures of CPD-MYL4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
270	AHWYDVEEFKEAFS	CPD	MYL4	chr17	28712254	chr17	45297270	1070

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CPD-MYL4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	270	AHWYDVEEFKEAFS	-4.94269	-5.69719
HLA-B14:02	3BVN	270	AHWYDVEEFKEAFS	-4.51593	-4.71043
HLA-B52:01	3W39	270	AHWYDVEEFKEAFS	-8.249	-8.4435
HLA-B52:01	3W39	270	AHWYDVEEFKEAFS	-7.17937	-7.93387
HLA-A11:01	4UQ2	270	AHWYDVEEFKEAFS	-8.03173	-8.22623
HLA-A11:01	4UQ2	270	AHWYDVEEFKEAFS	-4.95743	-5.71193
HLA-A24:02	5HGA	270	AHWYDVEEFKEAFS	-6.4174	-6.6119
HLA-A24:02	5HGA	270	AHWYDVEEFKEAFS	-4.65241	-5.40691
HLA-B27:05	6PYJ	270	AHWYDVEEFKEAFS	-7.17858	-7.93308
HLA-B27:05	6PYJ	270	AHWYDVEEFKEAFS	-3.10309	-3.29759
HLA-B44:05	3DX8	270	AHWYDVEEFKEAFS	-4.08639	-4.28089
HLA-B44:05	3DX8	270	AHWYDVEEFKEAFS	-3.78094	-4.53544

Top

Vaccine Design for the FusionNeoAntigens of CPD-MYL4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CPD-MYL4	chr17	28712254	chr17	45297270	10	19	DVEEFKEAF	ATGTGGAAGAGTTCAAAGAGGCCTTTT
CPD-MYL4	chr17	28712254	chr17	45297270	10	21	DVEEFKEAFSL	ATGTGGAAGAGTTCAAAGAGGCCTTTTCATTGT
CPD-MYL4	chr17	28712254	chr17	45297270	11	19	VEEFKEAF	TGGAAGAGTTCAAAGAGGCCTTTT
CPD-MYL4	chr17	28712254	chr17	45297270	11	21	VEEFKEAFSL	TGGAAGAGTTCAAAGAGGCCTTTTCATTGT
CPD-MYL4	chr17	28712254	chr17	45297270	12	21	EEFKEAFSL	AAGAGTTCAAAGAGGCCTTTTCATTGT
CPD-MYL4	chr17	28712254	chr17	45297270	12	22	EEFKEAFSLF	AAGAGTTCAAAGAGGCCTTTTCATTGTTTG
CPD-MYL4	chr17	28712254	chr17	45297270	4	15	NGAHWYDVEEF	ACGGCGCACATTGGTATGATGTGGAAGAGTTCA
CPD-MYL4	chr17	28712254	chr17	45297270	5	15	GAHWYDVEEF	GCGCACATTGGTATGATGTGGAAGAGTTCA
CPD-MYL4	chr17	28712254	chr17	45297270	6	15	AHWYDVEEF	CACATTGGTATGATGTGGAAGAGTTCA
CPD-MYL4	chr17	28712254	chr17	45297270	7	15	HWYDVEEF	ATTGGTATGATGTGGAAGAGTTCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CPD-MYL4	chr17	28712254	chr17	45297270	10	25	DVEEFKEAFSLFDRT	ATGTGGAAGAGTTCAAAGAGGCCTTTTCATTGTTTGACCGGACCC
CPD-MYL4	chr17	28712254	chr17	45297270	11	26	VEEFKEAFSLFDRTP	TGGAAGAGTTCAAAGAGGCCTTTTCATTGTTTGACCGGACCCCGA

Top

Information of the samples that have these potential fusion neoantigens of CPD-MYL4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	CPD-MYL4	chr17	28712254	ENST00000225719	chr17	45297270	ENST00000354968	TCGA-61-2111-01A

Top

Potential target of CAR-T therapy development for CPD-MYL4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CPD-MYL4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CPD-MYL4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)