Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CREB3L1-MGRN1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CREB3L1-MGRN1
	FusionPDB ID: 19315
	FusionGDB2.0 ID: 19315
		Hgene	Tgene
	Gene symbol	CREB3L1	MGRN1
	Gene ID	90993	23295
	Gene name	cAMP responsive element binding protein 3 like 1	mahogunin ring finger 1
	Synonyms	OASIS\|OI16	RNF156
	Cytomap	11p11.2	16p13.3
	Type of gene	protein-coding	protein-coding
	Description	cyclic AMP-responsive element-binding protein 3-like protein 1BBF-2 homologcAMP-responsive element-binding protein 3-like protein 1old astrocyte specifically-induced substance	E3 ubiquitin-protein ligase MGRN1RING finger protein 156RING-type E3 ubiquitin transferase MGRN1mahogunin RING finger protein 1mahogunin ring finger 1, E3 ubiquitin protein ligaseprobable E3 ubiquitin-protein ligase MGRN1
	Modification date	20200327	20200313
	UniProtAcc	Q96BA8 Main function of 5'-partner protein: FUNCTION: Transcription factor involved in unfolded protein response (UPR). Binds the DNA consensus sequence 5'-GTGXGCXGC-3' (PubMed:21767813). In the absence of endoplasmic reticulum (ER) stress, inserted into ER membranes, with N-terminal DNA-binding and transcription activation domains oriented toward the cytosolic face of the membrane. In response to ER stress, transported to the Golgi, where it is cleaved in a site-specific manner by resident proteases S1P/MBTPS1 and S2P/MBTPS2. The released N-terminal cytosolic domain is translocated to the nucleus to effect transcription of specific target genes. Plays a critical role in bone formation through the transcription of COL1A1, and possibly COL1A2, and the secretion of bone matrix proteins. Directly binds to the UPR element (UPRE)-like sequence in an osteoblast-specific COL1A1 promoter region and induces its transcription. Does not regulate COL1A1 in other tissues, such as skin (By similarity). Required to protect astrocytes from ER stress-induced cell death. In astrocytes, binds to the cAMP response element (CRE) of the BiP/HSPA5 promoter and participate in its transcriptional activation (By similarity). Required for TGFB1 to activate genes involved in the assembly of collagen extracellular matrix (PubMed:25310401). {ECO:0000250\|UniProtKB:Q9Z125, ECO:0000269\|PubMed:12054625, ECO:0000269\|PubMed:21767813, ECO:0000269\|PubMed:25310401}.; FUNCTION: (Microbial infection) May play a role in limiting virus spread by inhibiting proliferation of virus-infected cells. Upon infection with diverse DNA and RNA viruses, inhibits cell-cycle progression by binding to promoters and activating transcription of genes encoding cell-cycle inhibitors, such as p21/CDKN1A (PubMed:21767813). {ECO:0000269\|PubMed:21767813}.	O60291 Main function of 5'-partner protein: FUNCTION: E3 ubiquitin-protein ligase. Mediates monoubiquitination at multiple sites of TSG101 in the presence of UBE2D1, but not of UBE2G1, nor UBE2H. Plays a role in the regulation of endosome-to-lysosome trafficking. Impairs MC1R- and MC4R-signaling by competing with GNAS-binding to MCRs and inhibiting agonist-induced cAMP production. Does not inhibit ADRB2-signaling. Does not promote MC1R ubiquitination. Acts also as a negative regulator of hedgehog signaling (By similarity). {ECO:0000250\|UniProtKB:Q9D074, ECO:0000269\|PubMed:17229889, ECO:0000269\|PubMed:19703557, ECO:0000269\|PubMed:19737927}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000288400, ENST00000529193, ENST00000534616,	ENST00000588015, ENST00000262370, ENST00000399577, ENST00000415496, ENST00000586183, ENST00000588994,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 6 X 2=72	8 X 12 X 6=576
	# samples	7	11
	** MAII score	log2(7/72*10)=-0.0406419844973459 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/576*10)=-2.38856528791765 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CREB3L1 [Title/Abstract] AND MGRN1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CREB3L1 [Title/Abstract] AND MGRN1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CREB3L1(46321714)-MGRN1(4727463), # samples:1 CREB3L1(46321714)-MGRN1(4727464), # samples:1
Anticipated loss of major functional domain due to fusion event.	CREB3L1-MGRN1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CREB3L1-MGRN1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CREB3L1-MGRN1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CREB3L1-MGRN1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CREB3L1	GO:0010629	negative regulation of gene expression	27121396
Hgene	CREB3L1	GO:0032967	positive regulation of collagen biosynthetic process	25310401
Hgene	CREB3L1	GO:0040037	negative regulation of fibroblast growth factor receptor signaling pathway	27121396
Hgene	CREB3L1	GO:0045892	negative regulation of transcription, DNA-templated	27121396
Tgene	MGRN1	GO:0043951	negative regulation of cAMP-mediated signaling	19737927
Tgene	MGRN1	GO:0045744	negative regulation of G protein-coupled receptor signaling pathway	19737927

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:46321714/chr16:4727463)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CREB3L1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MGRN1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000262370	MGRN1	chr16	4727463	+	3622	782	451	1557	368
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000415496	MGRN1	chr16	4727463	+	6095	782	451	1419	322
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000399577	MGRN1	chr16	4727463	+	6159	782	451	1485	344
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000588994	MGRN1	chr16	4727463	+	1492	782	451	1491	347
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000586183	MGRN1	chr16	4727463	+	1668	782	451	1419	322
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000262370	MGRN1	chr16	4727463	+	3606	766	435	1541	368
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000415496	MGRN1	chr16	4727463	+	6079	766	435	1403	322
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000399577	MGRN1	chr16	4727463	+	6143	766	435	1469	344
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000588994	MGRN1	chr16	4727463	+	1476	766	435	1475	346
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000586183	MGRN1	chr16	4727463	+	1652	766	435	1403	322
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000262370	MGRN1	chr16	4727464	+	3622	782	451	1557	368
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000415496	MGRN1	chr16	4727464	+	6095	782	451	1419	322
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000399577	MGRN1	chr16	4727464	+	6159	782	451	1485	344
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000588994	MGRN1	chr16	4727464	+	1492	782	451	1491	347
ENST00000529193	CREB3L1	chr11	46321714	+	ENST00000586183	MGRN1	chr16	4727464	+	1668	782	451	1419	322
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000262370	MGRN1	chr16	4727464	+	3606	766	435	1541	368
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000415496	MGRN1	chr16	4727464	+	6079	766	435	1403	322
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000399577	MGRN1	chr16	4727464	+	6143	766	435	1469	344
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000588994	MGRN1	chr16	4727464	+	1476	766	435	1475	346
ENST00000288400	CREB3L1	chr11	46321714	+	ENST00000586183	MGRN1	chr16	4727464	+	1652	766	435	1403	322

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000529193	ENST00000262370	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.012500621	0.9874994
ENST00000529193	ENST00000415496	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.005296792	0.99470323
ENST00000529193	ENST00000399577	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.006698198	0.99330187
ENST00000529193	ENST00000588994	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.012099976	0.9879
ENST00000529193	ENST00000586183	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.007065564	0.99293447
ENST00000288400	ENST00000262370	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.012288905	0.98771113
ENST00000288400	ENST00000415496	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.005271983	0.994728
ENST00000288400	ENST00000399577	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.006673693	0.9933263
ENST00000288400	ENST00000588994	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.010801755	0.98919827
ENST00000288400	ENST00000586183	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727463	+	0.006454233	0.9935457
ENST00000529193	ENST00000262370	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.012500621	0.9874994
ENST00000529193	ENST00000415496	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.005296792	0.99470323
ENST00000529193	ENST00000399577	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.006698198	0.99330187
ENST00000529193	ENST00000588994	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.012099976	0.9879
ENST00000529193	ENST00000586183	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.007065564	0.99293447
ENST00000288400	ENST00000262370	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.012288905	0.98771113
ENST00000288400	ENST00000415496	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.005271983	0.994728
ENST00000288400	ENST00000399577	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.006673693	0.9933263
ENST00000288400	ENST00000588994	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.010801755	0.98919827
ENST00000288400	ENST00000586183	CREB3L1	chr11	46321714	+	MGRN1	chr16	4727464	+	0.006454233	0.9935457

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CREB3L1-MGRN1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CREB3L1	chr11	46321714	MGRN1	chr16	4727463	766	110	SPLVPIKMEDTTQAFRALLQIRAVRK
CREB3L1	chr11	46321714	MGRN1	chr16	4727463	782	110	SPLVPIKMEDTTQAFRALLQIRAVRK
CREB3L1	chr11	46321714	MGRN1	chr16	4727464	766	110	SPLVPIKMEDTTQAFRALLQIRAVRK
CREB3L1	chr11	46321714	MGRN1	chr16	4727464	782	110	SPLVPIKMEDTTQAFRALLQIRAVRK

Top

Potential FusionNeoAntigen Information of CREB3L1-MGRN1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CREB3L1-MGRN1_46321714_4727463.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:01	MEDTTQAF	0.9718	0.8031	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B51:02	QAFRALLQI	0.995	0.5084	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B52:01	QAFRALLQI	0.9898	0.9812	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:01	KMEDTTQAF	0.9897	0.8674	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:16	QAFRALLQI	0.989	0.8705	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B39:06	IKMEDTTQA	0.9567	0.8309	5	14
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:25	KMEDTTQAF	0.8675	0.9122	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:02	KMEDTTQAF	0.8556	0.9184	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B13:02	QAFRALLQI	0.8145	0.914	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:03	KMEDTTQAF	0.7541	0.6997	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:18	KMEDTTQAF	0.6625	0.6711	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-A32:13	KMEDTTQAF	0.5502	0.9553	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B13:01	KMEDTTQAF	0.0684	0.7694	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:18	IKMEDTTQAF	0.9723	0.5971	5	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:03	IKMEDTTQAF	0.9709	0.6418	5	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B13:02	TQAFRALLQI	0.7553	0.8163	11	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B14:03	TQAFRALL	0.9628	0.632	11	19
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B39:08	MEDTTQAF	0.9391	0.8947	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C15:06	QAFRALLQI	0.9992	0.9245	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C05:09	KMEDTTQAF	0.9989	0.8791	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C04:10	KMEDTTQAF	0.9987	0.7365	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C04:07	KMEDTTQAF	0.9987	0.749	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C08:15	KMEDTTQAF	0.9972	0.94	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B51:07	QAFRALLQI	0.9896	0.8088	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C06:03	QAFRALLQI	0.9791	0.9951	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C12:04	QAFRALLQI	0.9786	0.9948	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C12:12	QAFRALLQI	0.9578	0.9403	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:07	KMEDTTQAF	0.9144	0.6562	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C02:06	QAFRALLQI	0.9129	0.969	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:21	KMEDTTQAF	0.8444	0.8937	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:04	KMEDTTQAF	0.8205	0.8799	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C03:14	KMEDTTQAF	0.6634	0.9728	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:05	KMEDTTQAF	0.6467	0.8097	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C04:14	KMEDTTQAF	0.6429	0.8233	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C04:06	KMEDTTQAF	0.586	0.9075	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:31	KMEDTTQAF	0.5816	0.8262	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B39:08	KMEDTTQAF	0.2933	0.7754	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:05	IKMEDTTQAF	0.9134	0.8345	5	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B54:01	VPIKMEDTTQA	0.9963	0.5962	3	14
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B39:08	MEDTTQAFRAL	0.9961	0.864	7	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B40:04	MEDTTQAF	0.9973	0.7105	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:11	MEDTTQAF	0.9754	0.858	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:06	MEDTTQAF	0.9747	0.8095	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:05	MEDTTQAF	0.9718	0.8031	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:03	MEDTTQAF	0.9714	0.7975	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:07	MEDTTQAF	0.9684	0.772	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:08	MEDTTQAF	0.9614	0.8406	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B18:04	MEDTTQAF	0.9468	0.8229	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B35:20	MEDTTQAF	0.7772	0.9486	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B41:03	MEDTTQAF	0.7357	0.6895	7	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C15:02	QAFRALLQI	0.9993	0.9033	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C15:05	QAFRALLQI	0.9991	0.9513	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C05:01	KMEDTTQAF	0.9989	0.8791	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C04:03	KMEDTTQAF	0.9988	0.7589	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C04:01	KMEDTTQAF	0.9987	0.749	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C18:01	KMEDTTQAF	0.9979	0.726	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C08:02	KMEDTTQAF	0.9972	0.94	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-A25:01	DTTQAFRAL	0.9959	0.7993	9	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:33	KMEDTTQAF	0.9897	0.8674	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:125	KMEDTTQAF	0.9897	0.8674	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:34	KMEDTTQAF	0.9897	0.8674	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:27	KMEDTTQAF	0.9894	0.8884	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:135	KMEDTTQAF	0.988	0.8621	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:08	KMEDTTQAF	0.9846	0.8352	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:50	KMEDTTQAF	0.9814	0.8981	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:24	KMEDTTQAF	0.9785	0.9019	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B51:09	QAFRALLQI	0.9709	0.5971	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:53	KMEDTTQAF	0.9588	0.8429	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:12	KMEDTTQAF	0.9567	0.8083	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:35	KMEDTTQAF	0.9458	0.8307	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C12:03	QAFRALLQI	0.9286	0.9845	12	21
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:39	KMEDTTQAF	0.886	0.7852	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:54	KMEDTTQAF	0.8788	0.8144	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-A69:01	DTTQAFRAL	0.8339	0.5102	9	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-A32:01	KMEDTTQAF	0.8267	0.9535	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:73	KMEDTTQAF	0.7858	0.812	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C03:02	KMEDTTQAF	0.7583	0.9558	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C03:67	KMEDTTQAF	0.7226	0.9703	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:13	KMEDTTQAF	0.7194	0.6247	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:68	KMEDTTQAF	0.683	0.5577	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:20	KMEDTTQAF	0.6498	0.8818	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B35:28	KMEDTTQAF	0.6208	0.8779	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B48:02	KMEDTTQAF	0.5818	0.8561	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:30	KMEDTTQAF	0.5718	0.8428	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-C04:04	KMEDTTQAF	0.5591	0.912	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B35:20	KMEDTTQAF	0.5288	0.8926	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B07:13	KMEDTTQAF	0.1035	0.6239	6	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:54	IKMEDTTQAF	0.9873	0.8051	5	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:68	IKMEDTTQAF	0.9818	0.5815	5	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B15:53	IKMEDTTQAF	0.9742	0.825	5	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B48:02	IKMEDTTQAF	0.9225	0.8494	5	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	HLA-B41:03	MEDTTQAFRAL	0.9663	0.6788	7	18

Top

Potential FusionNeoAntigen Information of CREB3L1-MGRN1 in HLA II

CREB3L1-MGRN1_46321714_4727463.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0401	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0401	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0401	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0403	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0403	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0413	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0413	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0413	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0413	SPLVPIKMEDTTQAF	0	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0415	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0419	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0422	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0422	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0422	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0422	SPLVPIKMEDTTQAF	0	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0427	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0427	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0433	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0433	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0433	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0434	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0434	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0435	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0435	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0436	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0438	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0438	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0439	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0439	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0440	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0440	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0440	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0441	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0441	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0442	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0442	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0444	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0444	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0444	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0444	SPLVPIKMEDTTQAF	0	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0446	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0446	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0449	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0449	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0450	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0450	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0451	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0451	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0452	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0452	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0453	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0455	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0455	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0456	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0456	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0456	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0459	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0460	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0460	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0461	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0463	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0463	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0463	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0464	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0464	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0467	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0468	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0468	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0468	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0470	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0470	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0470	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0471	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0471	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0472	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0472	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0472	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0473	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0474	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0475	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0476	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0476	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0476	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0478	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0478	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0479	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0479	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0479	VPIKMEDTTQAFRAL	3	18
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0479	SPLVPIKMEDTTQAF	0	15
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0485	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0485	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0488	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-0832	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1105	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1130	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1130	TTQAFRALLQIRAVR	10	25
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1172	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1172	TTQAFRALLQIRAVR	10	25
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1216	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1216	TTQAFRALLQIRAVR	10	25
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1326	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1446	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1604	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB1-1609	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB3-0204	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB4-0104	LVPIKMEDTTQAFRA	2	17
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB4-0104	PLVPIKMEDTTQAFR	1	16
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB5-0102	TQAFRALLQIRAVRK	11	26
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	766	DRB5-0108N	TQAFRALLQIRAVRK	11	26

Top

Fusion breakpoint peptide structures of CREB3L1-MGRN1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4429	KMEDTTQAFRALLQ	CREB3L1	MGRN1	chr11	46321714	chr16	4727463	766

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CREB3L1-MGRN1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4429	KMEDTTQAFRALLQ	-7.9962	-8.1096
HLA-B14:02	3BVN	4429	KMEDTTQAFRALLQ	-5.70842	-6.74372
HLA-B52:01	3W39	4429	KMEDTTQAFRALLQ	-6.83737	-6.95077
HLA-B52:01	3W39	4429	KMEDTTQAFRALLQ	-4.4836	-5.5189
HLA-A11:01	4UQ2	4429	KMEDTTQAFRALLQ	-10.0067	-10.1201
HLA-A11:01	4UQ2	4429	KMEDTTQAFRALLQ	-9.03915	-10.0745
HLA-A24:02	5HGA	4429	KMEDTTQAFRALLQ	-6.56204	-6.67544
HLA-A24:02	5HGA	4429	KMEDTTQAFRALLQ	-5.42271	-6.45801
HLA-B44:05	3DX8	4429	KMEDTTQAFRALLQ	-7.85648	-8.89178
HLA-B44:05	3DX8	4429	KMEDTTQAFRALLQ	-5.3978	-5.5112
HLA-A02:01	6TDR	4429	KMEDTTQAFRALLQ	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of CREB3L1-MGRN1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	11	19	TQAFRALL	CCCAAGCTTTCCGGGCCCTCCTGC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	11	21	TQAFRALLQI	CCCAAGCTTTCCGGGCCCTCCTGCAGATCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	12	21	QAFRALLQI	AAGCTTTCCGGGCCCTCCTGCAGATCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	3	14	VPIKMEDTTQA	TGCCCATCAAGATGGAGGACACCACCCAAGCTT
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	5	14	IKMEDTTQA	TCAAGATGGAGGACACCACCCAAGCTT
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	5	15	IKMEDTTQAF	TCAAGATGGAGGACACCACCCAAGCTTTCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	6	15	KMEDTTQAF	AGATGGAGGACACCACCCAAGCTTTCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	7	15	MEDTTQAF	TGGAGGACACCACCCAAGCTTTCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	7	18	MEDTTQAFRAL	TGGAGGACACCACCCAAGCTTTCCGGGCCCTCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	9	18	DTTQAFRAL	ACACCACCCAAGCTTTCCGGGCCCTCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	0	15	SPLVPIKMEDTTQAF	GCCCCCTTGTGCCCATCAAGATGGAGGACACCACCCAAGCTTTCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	1	16	PLVPIKMEDTTQAFR	CCCTTGTGCCCATCAAGATGGAGGACACCACCCAAGCTTTCCGGG
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	10	25	TTQAFRALLQIRAVR	CCACCCAAGCTTTCCGGGCCCTCCTGCAGATCCGGGCGGTGCGGA
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	11	26	TQAFRALLQIRAVRK	CCCAAGCTTTCCGGGCCCTCCTGCAGATCCGGGCGGTGCGGAAGA
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	2	17	LVPIKMEDTTQAFRA	TTGTGCCCATCAAGATGGAGGACACCACCCAAGCTTTCCGGGCCC
CREB3L1-MGRN1	chr11	46321714	chr16	4727463	3	18	VPIKMEDTTQAFRAL	TGCCCATCAAGATGGAGGACACCACCCAAGCTTTCCGGGCCCTCC

Top

Information of the samples that have these potential fusion neoantigens of CREB3L1-MGRN1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	CREB3L1-MGRN1	chr11	46321714	ENST00000288400	chr16	4727463	ENST00000262370	TCGA-EQ-A4SO

Top

Potential target of CAR-T therapy development for CREB3L1-MGRN1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CREB3L1-MGRN1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CREB3L1-MGRN1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)