|
|||||||
|
Fusion Protein:CSNK1E-DDX17 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: CSNK1E-DDX17 | FusionPDB ID: 19830 | FusionGDB2.0 ID: 19830 | Hgene | Tgene | Gene symbol | CSNK1E | DDX17 | Gene ID | 1454 | 10521 |
| Gene name | casein kinase 1 epsilon | DEAD-box helicase 17 | |
| Synonyms | CKIe|CKIepsilon|HCKIE | P72|RH70 | |
| Cytomap | 22q13.1 | 22q13.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | casein kinase I isoform epsilon | probable ATP-dependent RNA helicase DDX17DEAD (Asp-Glu-Ala-Asp) box helicase 17DEAD (Asp-Glu-Ala-Asp) box polypeptide 17DEAD box protein p72DEAD box protein p82DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)RNA-dependent helicase p72 | |
| Modification date | 20200329 | 20200327 | |
| UniProtAcc | P49674 Main function of 5'-partner protein: FUNCTION: Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. Can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates DVL1 and DVL2. Central component of the circadian clock. In balance with PP1, determines the circadian period length, through the regulation of the speed and rhythmicity of PER1 and PER2 phosphorylation. Controls PER1 and PER2 nuclear transport and degradation. Inhibits cytokine-induced granuloytic differentiation. {ECO:0000269|PubMed:12556519, ECO:0000269|PubMed:15070676, ECO:0000269|PubMed:15917222, ECO:0000269|PubMed:16790549, ECO:0000269|PubMed:23413191}. | Q92841 Main function of 5'-partner protein: FUNCTION: As an RNA helicase, unwinds RNA and alters RNA structures through ATP binding and hydrolysis. Involved in multiple cellular processes, including pre-mRNA splicing, alternative splicing, ribosomal RNA processing and miRNA processing, as well as transcription regulation. Regulates the alternative splicing of exons exhibiting specific features (PubMed:12138182, PubMed:23022728, PubMed:24910439, PubMed:22266867). For instance, promotes the inclusion of AC-rich alternative exons in CD44 transcripts (PubMed:12138182). This function requires the RNA helicase activity (PubMed:12138182, PubMed:23022728, PubMed:24910439, PubMed:22266867). Affects NFAT5 and histone macro-H2A.1/MACROH2A1 alternative splicing in a CDK9-dependent manner (PubMed:26209609, PubMed:22266867). In NFAT5, promotes the introduction of alternative exon 4, which contains 2 stop codons and may target NFAT5 exon 4-containing transcripts to nonsense-mediated mRNA decay, leading to the down-regulation of NFAT5 protein (PubMed:22266867). Affects splicing of mediators of steroid hormone signaling pathway, including kinases that phosphorylates ESR1, such as CDK2, MAPK1 and GSK3B, and transcriptional regulators, such as CREBBP, MED1, NCOR1 and NCOR2. By affecting GSK3B splicing, participates in ESR1 and AR stabilization (PubMed:24275493). In myoblasts and epithelial cells, cooperates with HNRNPH1 to control the splicing of specific subsets of exons (PubMed:24910439). In addition to binding mature mRNAs, also interacts with certain pri-microRNAs, including MIR663/miR-663a, MIR99B/miR-99b, and MIR6087/miR-6087 (PubMed:25126784). Binds pri-microRNAs on the 3' segment flanking the stem loop via the 5'-[ACG]CAUC[ACU]-3' consensus sequence (PubMed:24581491). Required for the production of subsets of microRNAs, including MIR21 and MIR125B1 (PubMed:24581491, PubMed:27478153). May be involved not only in microRNA primary transcript processing, but also stabilization (By similarity). Participates in MYC down-regulation at high cell density through the production of MYC-targeting microRNAs (PubMed:24581491). Along with DDX5, may be involved in the processing of the 32S intermediate into the mature 28S ribosomal RNA (PubMed:17485482). Promoter-specific transcription regulator, functioning as a coactivator or corepressor depending on the context of the promoter and the transcriptional complex in which it exists (PubMed:15298701). Enhances NFAT5 transcriptional activity (PubMed:22266867). Synergizes with TP53 in the activation of the MDM2 promoter; this activity requires acetylation on lysine residues (PubMed:17226766, PubMed:20663877, PubMed:19995069). May also coactivate MDM2 transcription through a TP53-independent pathway (PubMed:17226766). Coactivates MMP7 transcription (PubMed:17226766). Along with CTNNB1, coactivates MYC, JUN, FOSL1 and cyclin D1/CCND1 transcription (PubMed:17699760). Alone or in combination with DDX5 and/or SRA1 non-coding RNA, plays a critical role in promoting the assembly of proteins required for the formation of the transcription initiation complex and chromatin remodeling leading to coactivation of MYOD1-dependent transcription. This helicase-independent activity is required for skeletal muscle cells to properly differentiate into myotubes (PubMed:17011493, PubMed:24910439). During epithelial-to-mesenchymal transition, coregulates SMAD-dependent transcriptional activity, directly controlling key effectors of differentiation, including miRNAs which in turn directly repress its expression (PubMed:24910439). Plays a role in estrogen and testosterone signaling pathway at several levels. Mediates the use of alternative promoters in estrogen-responsive genes and regulates transcription and splicing of a large number of steroid hormone target genes (PubMed:24275493, PubMed:20406972, PubMed:20663877, PubMed:19995069). Contrary to splicing regulation activity, transcriptional coregulation of the estrogen receptor ESR1 is helicase-independent (PubMed:19718048, PubMed:24275493). Plays a role in innate immunity. Specifically restricts bunyavirus infection, including Rift Valley fever virus (RVFV) or La Crosse virus (LACV), but not vesicular stomatitis virus (VSV), in an interferon- and DROSHA-independent manner (PubMed:25126784). Binds to RVFV RNA, likely via structured viral RNA elements (PubMed:25126784). Promotes mRNA degradation mediated by the antiviral zinc-finger protein ZC3HAV1, in an ATPase-dependent manner (PubMed:18334637). {ECO:0000250|UniProtKB:Q501J6, ECO:0000269|PubMed:12138182, ECO:0000269|PubMed:15298701, ECO:0000269|PubMed:17011493, ECO:0000269|PubMed:17226766, ECO:0000269|PubMed:17485482, ECO:0000269|PubMed:17699760, ECO:0000269|PubMed:18334637, ECO:0000269|PubMed:19718048, ECO:0000269|PubMed:19995069, ECO:0000269|PubMed:20406972, ECO:0000269|PubMed:20663877, ECO:0000269|PubMed:22266867, ECO:0000269|PubMed:23022728, ECO:0000269|PubMed:24275493, ECO:0000269|PubMed:24581491, ECO:0000269|PubMed:24910439, ECO:0000269|PubMed:25126784, ECO:0000269|PubMed:26209609, ECO:0000269|PubMed:27478153, ECO:0000305}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000359867, ENST00000396832, ENST00000400206, ENST00000403904, ENST00000405675, ENST00000413574, ENST00000498529, | ENST00000432525, ENST00000444597, ENST00000381633, ENST00000396821, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 9 X 10=1170 | 20 X 21 X 7=2940 |
| # samples | 17 | 25 | |
| ** MAII score | log2(17/1170*10)=-2.78290187833307 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(25/2940*10)=-3.55581615506164 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: CSNK1E [Title/Abstract] AND DDX17 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: CSNK1E [Title/Abstract] AND DDX17 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CSNK1E(38690410)-DDX17(38881123), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | CSNK1E-DDX17 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CSNK1E-DDX17 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CSNK1E-DDX17 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. CSNK1E-DDX17 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. CSNK1E-DDX17 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. CSNK1E-DDX17 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | CSNK1E | GO:0006468 | protein phosphorylation | 15917222|17244647 |
| Hgene | CSNK1E | GO:0018105 | peptidyl-serine phosphorylation | 25500533 |
| Hgene | CSNK1E | GO:0032091 | negative regulation of protein binding | 23109420 |
| Hgene | CSNK1E | GO:0060070 | canonical Wnt signaling pathway | 14722104 |
| Hgene | CSNK1E | GO:1903827 | regulation of cellular protein localization | 17244647 |
| Tgene | DDX17 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 17226766 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr22:38690410/chr22:38881123) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across CSNK1E (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across DDX17 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000359867 | CSNK1E | chr22 | 38710086 | - | ENST00000396821 | DDX17 | chr22 | 38882445 | - | 3188 | 187 | 111 | 692 | 193 |
| ENST00000359867 | CSNK1E | chr22 | 38710086 | - | ENST00000381633 | DDX17 | chr22 | 38882445 | - | 3164 | 187 | 111 | 692 | 193 |
| ENST00000396832 | CSNK1E | chr22 | 38710086 | - | ENST00000396821 | DDX17 | chr22 | 38882445 | - | 3338 | 337 | 261 | 842 | 193 |
| ENST00000396832 | CSNK1E | chr22 | 38710086 | - | ENST00000381633 | DDX17 | chr22 | 38882445 | - | 3314 | 337 | 261 | 842 | 193 |
| ENST00000400206 | CSNK1E | chr22 | 38710086 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3519 | 542 | 466 | 1047 | 193 |
| ENST00000403904 | CSNK1E | chr22 | 38710086 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3345 | 368 | 292 | 873 | 193 |
| ENST00000413574 | CSNK1E | chr22 | 38710086 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3317 | 340 | 264 | 845 | 193 |
| ENST00000405675 | CSNK1E | chr22 | 38710086 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3345 | 368 | 292 | 873 | 193 |
| ENST00000359867 | CSNK1E | chr22 | 38710087 | - | ENST00000396821 | DDX17 | chr22 | 38882445 | - | 3188 | 187 | 111 | 692 | 193 |
| ENST00000359867 | CSNK1E | chr22 | 38710087 | - | ENST00000381633 | DDX17 | chr22 | 38882445 | - | 3164 | 187 | 111 | 692 | 193 |
| ENST00000396832 | CSNK1E | chr22 | 38710087 | - | ENST00000396821 | DDX17 | chr22 | 38882445 | - | 3338 | 337 | 261 | 842 | 193 |
| ENST00000396832 | CSNK1E | chr22 | 38710087 | - | ENST00000381633 | DDX17 | chr22 | 38882445 | - | 3314 | 337 | 261 | 842 | 193 |
| ENST00000400206 | CSNK1E | chr22 | 38710087 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3519 | 542 | 466 | 1047 | 193 |
| ENST00000403904 | CSNK1E | chr22 | 38710087 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3345 | 368 | 292 | 873 | 193 |
| ENST00000413574 | CSNK1E | chr22 | 38710087 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3317 | 340 | 264 | 845 | 193 |
| ENST00000405675 | CSNK1E | chr22 | 38710087 | - | ENST00000444597 | DDX17 | chr22 | 38882445 | - | 3345 | 368 | 292 | 873 | 193 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000359867 | ENST00000396821 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.002418901 | 0.9975811 |
| ENST00000359867 | ENST00000381633 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.001823295 | 0.9981767 |
| ENST00000396832 | ENST00000396821 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.002392605 | 0.99760735 |
| ENST00000396832 | ENST00000381633 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.001797139 | 0.9982028 |
| ENST00000400206 | ENST00000444597 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.0020375 | 0.9979625 |
| ENST00000403904 | ENST00000444597 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.001837855 | 0.9981622 |
| ENST00000413574 | ENST00000444597 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.001790535 | 0.9982095 |
| ENST00000405675 | ENST00000444597 | CSNK1E | chr22 | 38710086 | - | DDX17 | chr22 | 38882445 | - | 0.001837855 | 0.9981622 |
| ENST00000359867 | ENST00000396821 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.002418901 | 0.9975811 |
| ENST00000359867 | ENST00000381633 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.001823295 | 0.9981767 |
| ENST00000396832 | ENST00000396821 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.002392605 | 0.99760735 |
| ENST00000396832 | ENST00000381633 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.001797139 | 0.9982028 |
| ENST00000400206 | ENST00000444597 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.0020375 | 0.9979625 |
| ENST00000403904 | ENST00000444597 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.001837855 | 0.9981622 |
| ENST00000413574 | ENST00000444597 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.001790535 | 0.9982095 |
| ENST00000405675 | ENST00000444597 | CSNK1E | chr22 | 38710087 | - | DDX17 | chr22 | 38882445 | - | 0.001837855 | 0.9981622 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CSNK1E-DDX17 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| CSNK1E | chr22 | 38710086 | DDX17 | chr22 | 38882445 | 187 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710086 | DDX17 | chr22 | 38882445 | 337 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710086 | DDX17 | chr22 | 38882445 | 340 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710086 | DDX17 | chr22 | 38882445 | 368 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710086 | DDX17 | chr22 | 38882445 | 542 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710087 | DDX17 | chr22 | 38882445 | 187 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710087 | DDX17 | chr22 | 38882445 | 337 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710087 | DDX17 | chr22 | 38882445 | 340 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710087 | DDX17 | chr22 | 38882445 | 368 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
| CSNK1E | chr22 | 38710087 | DDX17 | chr22 | 38882445 | 542 | 24 | GRKIGSGSFGDIYLGGRSRYRTTSSA |
Top |
Potential FusionNeoAntigen Information of CSNK1E-DDX17 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| CSNK1E-DDX17_38710086_38882445.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A66:01 | DIYLGGRSR | 0.9965 | 0.7135 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A33:05 | DIYLGGRSR | 0.9959 | 0.5893 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A33:01 | DIYLGGRSR | 0.9959 | 0.5893 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A68:03 | DIYLGGRSR | 0.9956 | 0.6347 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A68:24 | DIYLGGRSR | 0.9955 | 0.6558 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A68:06 | DIYLGGRSR | 0.9835 | 0.5302 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A26:03 | DIYLGGRSR | 0.969 | 0.7176 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A68:05 | DIYLGGRSR | 0.9622 | 0.6385 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A34:05 | DIYLGGRSR | 0.8979 | 0.6948 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A34:01 | DIYLGGRSR | 0.8979 | 0.6948 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A68:08 | DIYLGGRSR | 0.8939 | 0.621 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A31:02 | YLGGRSRYR | 0.7787 | 0.626 | 12 | 21 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A66:03 | DIYLGGRSR | 0.6917 | 0.5278 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A31:02 | IYLGGRSRYR | 0.9806 | 0.778 | 11 | 21 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-B15:02 | DIYLGGRSRY | 0.9633 | 0.9123 | 10 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A33:05 | DIYLGGRSRYR | 0.9985 | 0.6336 | 10 | 21 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A33:01 | DIYLGGRSRYR | 0.9985 | 0.6336 | 10 | 21 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A68:01 | DIYLGGRSR | 0.9955 | 0.6558 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:19 | IYLGGRSRY | 0.4823 | 0.6575 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:80 | IYLGGRSRY | 0.4251 | 0.9512 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:67 | IYLGGRSRY | 0.4251 | 0.9512 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:10 | IYLGGRSRY | 0.4013 | 0.9736 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:46 | IYLGGRSRY | 0.3962 | 0.886 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:27 | IYLGGRSRY | 0.2485 | 0.9486 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:05 | IYLGGRSRY | 0.1863 | 0.8948 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C12:16 | IYLGGRSRY | 0.0962 | 0.9754 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A33:03 | DIYLGGRSRYR | 0.98 | 0.5294 | 10 | 21 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A66:02 | DIYLGGRSR | 0.7522 | 0.5186 | 10 | 19 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:02 | IYLGGRSRY | 0.4251 | 0.9512 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:17 | IYLGGRSRY | 0.3889 | 0.9658 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:22 | IYLGGRSRY | 0.357 | 0.8382 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C07:01 | IYLGGRSRY | 0.3156 | 0.5992 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C06:06 | IYLGGRSRY | 0.0025 | 0.9894 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C14:03 | IYLGGRSRY | 0.0022 | 0.9688 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-C14:02 | IYLGGRSRY | 0.0022 | 0.9688 | 11 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-A25:01 | DIYLGGRSRY | 0.9804 | 0.877 | 10 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-B15:11 | DIYLGGRSRY | 0.9714 | 0.8428 | 10 | 20 |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 | HLA-B15:08 | DIYLGGRSRY | 0.9703 | 0.8431 | 10 | 20 |
Top |
Potential FusionNeoAntigen Information of CSNK1E-DDX17 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of CSNK1E-DDX17 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 3117 | GSFGDIYLGGRSRY | CSNK1E | DDX17 | chr22 | 38710086 | chr22 | 38882445 | 187 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CSNK1E-DDX17 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 3117 | GSFGDIYLGGRSRY | -6.07233 | -6.07953 |
| HLA-B52:01 | 3W39 | 3117 | GSFGDIYLGGRSRY | -5.45645 | -5.46365 |
| HLA-A24:02 | 5HGA | 3117 | GSFGDIYLGGRSRY | -3.85827 | -3.86547 |
| HLA-B44:05 | 3DX8 | 3117 | GSFGDIYLGGRSRY | -4.76301 | -4.77021 |
Top |
Vaccine Design for the FusionNeoAntigens of CSNK1E-DDX17 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 10 | 19 | DIYLGGRSR | TCTACCTGGGTGGTCGTTCTCGTTACC |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 10 | 20 | DIYLGGRSRY | TCTACCTGGGTGGTCGTTCTCGTTACCGGA |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 10 | 21 | DIYLGGRSRYR | TCTACCTGGGTGGTCGTTCTCGTTACCGGACCA |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 11 | 20 | IYLGGRSRY | ACCTGGGTGGTCGTTCTCGTTACCGGA |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 11 | 21 | IYLGGRSRYR | ACCTGGGTGGTCGTTCTCGTTACCGGACCA |
| CSNK1E-DDX17 | chr22 | 38710086 | chr22 | 38882445 | 12 | 21 | YLGGRSRYR | TGGGTGGTCGTTCTCGTTACCGGACCA |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of CSNK1E-DDX17 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| UCEC | CSNK1E-DDX17 | chr22 | 38710086 | ENST00000359867 | chr22 | 38882445 | ENST00000381633 | TCGA-B5-A0K8 |
Top |
Potential target of CAR-T therapy development for CSNK1E-DDX17 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CSNK1E-DDX17 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CSNK1E-DDX17 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies