![]() |
|||||||
|
Fusion Protein:CTNNA1-KDM3B |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: CTNNA1-KDM3B | FusionPDB ID: 20259 | FusionGDB2.0 ID: 20259 | Hgene | Tgene | Gene symbol | CTNNA1 | KDM3B | Gene ID | 1495 | 51780 |
Gene name | catenin alpha 1 | lysine demethylase 3B | |
Synonyms | CAP102|MDPT2 | 5qNCA|C5orf7|JMJD1B|NET22 | |
Cytomap | 5q31.2 | 5q31.2 | |
Type of gene | protein-coding | protein-coding | |
Description | catenin alpha-1alpha-E-catenincatenin (cadherin-associated protein), alpha 1, 102kDaepididymis secretory sperm binding proteinrenal carcinoma antigen NY-REN-13 | lysine-specific demethylase 3BjmjC domain-containing histone demethylation protein 2Bjumonji domain containing 1Bjumonji domain-containing protein 1Blysine (K)-specific demethylase 3Bnuclear protein 5qNCA | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | P35221 Main function of 5'-partner protein: FUNCTION: Associates with the cytoplasmic domain of a variety of cadherins. The association of catenins to cadherins produces a complex which is linked to the actin filament network, and which seems to be of primary importance for cadherins cell-adhesion properties. Can associate with both E- and N-cadherins. Originally believed to be a stable component of E-cadherin/catenin adhesion complexes and to mediate the linkage of cadherins to the actin cytoskeleton at adherens junctions. In contrast, cortical actin was found to be much more dynamic than E-cadherin/catenin complexes and CTNNA1 was shown not to bind to F-actin when assembled in the complex suggesting a different linkage between actin and adherens junctions components. The homodimeric form may regulate actin filament assembly and inhibit actin branching by competing with the Arp2/3 complex for binding to actin filaments. Involved in the regulation of WWTR1/TAZ, YAP1 and TGFB1-dependent SMAD2 and SMAD3 nuclear accumulation (By similarity). May play a crucial role in cell differentiation. {ECO:0000250|UniProtKB:P26231, ECO:0000269|PubMed:25653389}. | Q7LBC6 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-9' of histone H3, thereby playing a central role in histone code. Demethylation of Lys residue generates formaldehyde and succinate. May have tumor suppressor activity. {ECO:0000269|PubMed:16603237}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000302763, ENST00000355078, ENST00000518825, ENST00000520400, ENST00000540387, | ENST00000394866, ENST00000508386, ENST00000542866, ENST00000314358, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 25 X 19 X 12=5700 | 11 X 11 X 5=605 |
# samples | 34 | 13 | |
** MAII score | log2(34/5700*10)=-4.06735526780176 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(13/605*10)=-2.2184235191335 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: CTNNA1 [Title/Abstract] AND KDM3B [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: CTNNA1 [Title/Abstract] AND KDM3B [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CTNNA1(138163407)-KDM3B(137708362), # samples:1 CTNNA1(138163407)-KDM3B(137708363), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | CTNNA1-KDM3B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CTNNA1-KDM3B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CTNNA1-KDM3B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CTNNA1-KDM3B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | CTNNA1 | GO:0071681 | cellular response to indole-3-methanol | 10868478 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:138163407/chr5:137708362) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000355078 | CTNNA1 | chr5 | 138163407 | + | ENST00000314358 | KDM3B | chr5 | 137708362 | + | 7379 | 958 | 202 | 6051 | 1949 |
ENST00000302763 | CTNNA1 | chr5 | 138163407 | + | ENST00000314358 | KDM3B | chr5 | 137708362 | + | 7573 | 1152 | 90 | 6245 | 2051 |
ENST00000518825 | CTNNA1 | chr5 | 138163407 | + | ENST00000314358 | KDM3B | chr5 | 137708362 | + | 7485 | 1064 | 2 | 6157 | 2051 |
ENST00000355078 | CTNNA1 | chr5 | 138163407 | + | ENST00000314358 | KDM3B | chr5 | 137708363 | + | 7379 | 958 | 202 | 6051 | 1949 |
ENST00000302763 | CTNNA1 | chr5 | 138163407 | + | ENST00000314358 | KDM3B | chr5 | 137708363 | + | 7573 | 1152 | 90 | 6245 | 2051 |
ENST00000518825 | CTNNA1 | chr5 | 138163407 | + | ENST00000314358 | KDM3B | chr5 | 137708363 | + | 7485 | 1064 | 2 | 6157 | 2051 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000355078 | ENST00000314358 | CTNNA1 | chr5 | 138163407 | + | KDM3B | chr5 | 137708362 | + | 0.000794691 | 0.9992053 |
ENST00000302763 | ENST00000314358 | CTNNA1 | chr5 | 138163407 | + | KDM3B | chr5 | 137708362 | + | 0.000650799 | 0.9993492 |
ENST00000518825 | ENST00000314358 | CTNNA1 | chr5 | 138163407 | + | KDM3B | chr5 | 137708362 | + | 0.000556284 | 0.9994437 |
ENST00000355078 | ENST00000314358 | CTNNA1 | chr5 | 138163407 | + | KDM3B | chr5 | 137708363 | + | 0.000794691 | 0.9992053 |
ENST00000302763 | ENST00000314358 | CTNNA1 | chr5 | 138163407 | + | KDM3B | chr5 | 137708363 | + | 0.000650799 | 0.9993492 |
ENST00000518825 | ENST00000314358 | CTNNA1 | chr5 | 138163407 | + | KDM3B | chr5 | 137708363 | + | 0.000556284 | 0.9994437 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CTNNA1-KDM3B |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
CTNNA1 | chr5 | 138163407 | KDM3B | chr5 | 137708362 | 1064 | 354 | QALQDLLSEYMGNIFVEFDGCNWKQH |
CTNNA1 | chr5 | 138163407 | KDM3B | chr5 | 137708362 | 1152 | 354 | QALQDLLSEYMGNIFVEFDGCNWKQH |
CTNNA1 | chr5 | 138163407 | KDM3B | chr5 | 137708362 | 958 | 252 | QALQDLLSEYMGNIFVEFDGCNWKQH |
CTNNA1 | chr5 | 138163407 | KDM3B | chr5 | 137708363 | 1064 | 354 | QALQDLLSEYMGNIFVEFDGCNWKQH |
CTNNA1 | chr5 | 138163407 | KDM3B | chr5 | 137708363 | 1152 | 354 | QALQDLLSEYMGNIFVEFDGCNWKQH |
CTNNA1 | chr5 | 138163407 | KDM3B | chr5 | 137708363 | 958 | 252 | QALQDLLSEYMGNIFVEFDGCNWKQH |
Top |
Potential FusionNeoAntigen Information of CTNNA1-KDM3B in HLA I |
![]() |
CTNNA1-KDM3B_138163407_137708362.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:01 | SEYMGNIF | 0.9973 | 0.8453 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:01 | YMGNIFVEF | 0.997 | 0.9139 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B45:01 | SEYMGNIFV | 0.9935 | 0.5602 | 7 | 16 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:02 | YMGNIFVEF | 0.9849 | 0.9287 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:25 | YMGNIFVEF | 0.9831 | 0.9115 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-A02:13 | LLSEYMGNI | 0.9799 | 0.5026 | 5 | 14 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-A32:13 | YMGNIFVEF | 0.972 | 0.9446 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B41:01 | SEYMGNIFV | 0.4117 | 0.7441 | 7 | 16 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B13:01 | YMGNIFVEF | 0.2929 | 0.8476 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B39:13 | SEYMGNIFV | 0.1303 | 0.7408 | 7 | 16 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B52:01 | SEYMGNIFV | 0.0057 | 0.566 | 7 | 16 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B44:03 | SEYMGNIFVEF | 0.9997 | 0.9521 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:01 | SEYMGNIFVEF | 0.9944 | 0.9478 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:07 | YMGNIFVEF | 0.9959 | 0.7171 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:21 | YMGNIFVEF | 0.9854 | 0.9169 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:31 | YMGNIFVEF | 0.9631 | 0.9065 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:05 | YMGNIFVEF | 0.9586 | 0.8984 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-C03:14 | YMGNIFVEF | 0.9105 | 0.9817 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:11 | SEYMGNIF | 0.9976 | 0.7322 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:04 | SEYMGNIF | 0.9975 | 0.8606 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:08 | SEYMGNIF | 0.9974 | 0.7761 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:05 | SEYMGNIF | 0.9973 | 0.8453 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:06 | SEYMGNIF | 0.9972 | 0.8418 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B40:04 | SEYMGNIF | 0.9967 | 0.5155 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:03 | SEYMGNIF | 0.9964 | 0.8314 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:53 | SEYMGNIF | 0.9581 | 0.7822 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B48:02 | SEYMGNIF | 0.8994 | 0.7568 | 7 | 15 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:27 | YMGNIFVEF | 0.9973 | 0.9088 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:33 | YMGNIFVEF | 0.997 | 0.9139 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:34 | YMGNIFVEF | 0.997 | 0.9139 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:125 | YMGNIFVEF | 0.997 | 0.9139 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:135 | YMGNIFVEF | 0.9969 | 0.9047 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:35 | YMGNIFVEF | 0.9966 | 0.9017 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:50 | YMGNIFVEF | 0.9964 | 0.9573 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:12 | YMGNIFVEF | 0.9948 | 0.8625 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:24 | YMGNIFVEF | 0.9946 | 0.8506 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-A02:03 | LLSEYMGNI | 0.9941 | 0.5123 | 5 | 14 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-C12:02 | YMGNIFVEF | 0.9934 | 0.979 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-C03:02 | YMGNIFVEF | 0.9872 | 0.9628 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B40:04 | SEYMGNIFV | 0.9845 | 0.5724 | 7 | 16 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:39 | YMGNIFVEF | 0.9816 | 0.8261 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-A32:01 | YMGNIFVEF | 0.9696 | 0.9445 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:20 | YMGNIFVEF | 0.9604 | 0.931 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:13 | YMGNIFVEF | 0.958 | 0.6464 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B35:20 | YMGNIFVEF | 0.957 | 0.94 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B35:28 | YMGNIFVEF | 0.9518 | 0.9303 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-C07:17 | YMGNIFVEF | 0.9133 | 0.9667 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-C02:02 | YMGNIFVEF | 0.4356 | 0.9788 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-C02:10 | YMGNIFVEF | 0.4356 | 0.9788 | 9 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B39:02 | SEYMGNIFV | 0.0885 | 0.7464 | 7 | 16 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B44:07 | SEYMGNIFVEF | 0.9997 | 0.9521 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B44:13 | SEYMGNIFVEF | 0.9997 | 0.9521 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B44:26 | SEYMGNIFVEF | 0.9997 | 0.9521 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B15:53 | SEYMGNIFVEF | 0.9988 | 0.8622 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:11 | SEYMGNIFVEF | 0.9982 | 0.8854 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B40:04 | SEYMGNIFVEF | 0.998 | 0.6299 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:08 | SEYMGNIFVEF | 0.9953 | 0.9321 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:05 | SEYMGNIFVEF | 0.9944 | 0.9478 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B18:03 | SEYMGNIFVEF | 0.992 | 0.943 | 7 | 18 |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 | HLA-B48:02 | SEYMGNIFVEF | 0.9483 | 0.872 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of CTNNA1-KDM3B in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of CTNNA1-KDM3B |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5619 | LSEYMGNIFVEFDG | CTNNA1 | KDM3B | chr5 | 138163407 | chr5 | 137708362 | 1152 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CTNNA1-KDM3B |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5619 | LSEYMGNIFVEFDG | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 5619 | LSEYMGNIFVEFDG | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 5619 | LSEYMGNIFVEFDG | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 5619 | LSEYMGNIFVEFDG | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 5619 | LSEYMGNIFVEFDG | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 5619 | LSEYMGNIFVEFDG | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 5619 | LSEYMGNIFVEFDG | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 5619 | LSEYMGNIFVEFDG | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 5619 | LSEYMGNIFVEFDG | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 5619 | LSEYMGNIFVEFDG | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 5619 | LSEYMGNIFVEFDG | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of CTNNA1-KDM3B |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 5 | 14 | LLSEYMGNI | CTGCTTTCGGAGTACATGGGCAATATC |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 7 | 15 | SEYMGNIF | TCGGAGTACATGGGCAATATCTTT |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 7 | 16 | SEYMGNIFV | TCGGAGTACATGGGCAATATCTTTGTA |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 7 | 18 | SEYMGNIFVEF | TCGGAGTACATGGGCAATATCTTTGTAGAATTT |
CTNNA1-KDM3B | chr5 | 138163407 | chr5 | 137708362 | 9 | 18 | YMGNIFVEF | TACATGGGCAATATCTTTGTAGAATTT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of CTNNA1-KDM3B |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | CTNNA1-KDM3B | chr5 | 138163407 | ENST00000302763 | chr5 | 137708362 | ENST00000314358 | TCGA-09-0366 |
Top |
Potential target of CAR-T therapy development for CTNNA1-KDM3B |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CTNNA1-KDM3B |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CTNNA1-KDM3B |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |