|
|||||||
|
Fusion Protein:CUL3-DARS |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: CUL3-DARS | FusionPDB ID: 20665 | FusionGDB2.0 ID: 20665 | Hgene | Tgene | Gene symbol | CUL3 | DARS | Gene ID | 8452 | 1615 |
| Gene name | cullin 3 | aspartyl-tRNA synthetase 1 | |
| Synonyms | CUL-3|PHA2E | DARS|HBSL|aspRS | |
| Cytomap | 2q36.2 | 2q21.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | cullin-3 | aspartate--tRNA ligase, cytoplasmicaspartate tRNA ligase 1, cytoplasmicaspartyl-tRNA synthetase, cytoplasmiccell proliferation-inducing gene 40 proteintesticular tissue protein Li 192 | |
| Modification date | 20200327 | 20200313 | |
| UniProtAcc | Q13618 Main function of 5'-partner protein: FUNCTION: Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (PubMed:27565346). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1. The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component. BCR(KLHL42) is involved in ubiquitination of KATNA1. BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, MACROH2A1 and DAXX, GLI2 and GLI3. Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity. BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis. BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B) (PubMed:22358839, PubMed:27716508). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4 (PubMed:23387299, PubMed:23453970, PubMed:23576762). The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination (PubMed:20389280, PubMed:21840486, PubMed:21670212, PubMed:24768539). The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB (PubMed:19995937). The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation (PubMed:23455478). The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway (PubMed:29769719). The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1) (PubMed:22578813). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification (PubMed:26399832). Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition. Involved in the ubiquitination of KEAP1, ENC1 and KLHL41 (PubMed:15983046). In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM. The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (PubMed:25270598). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (PubMed:27798626). The BCR(KLHL18) E3 ubiquitin ligase complex mediates the ubiquitination of AURKA leading to its activation at the centrosome which is required for initiating mitotic entry (PubMed:23213400). The BCR(KEAP1) E3 ubiquitin ligase complex acts as a key sensor of oxidative and electrophilic stress by mediating ubiquitination and degradation of NFE2L2/NRF2, a transcription factor regulating expression of many cytoprotective genes (PubMed:15601839, PubMed:16006525). {ECO:0000269|PubMed:10500095, ECO:0000269|PubMed:11311237, ECO:0000269|PubMed:15601839, ECO:0000269|PubMed:15897469, ECO:0000269|PubMed:15983046, ECO:0000269|PubMed:16006525, ECO:0000269|PubMed:16524876, ECO:0000269|PubMed:17543862, ECO:0000269|PubMed:18397884, ECO:0000269|PubMed:19261606, ECO:0000269|PubMed:19995937, ECO:0000269|PubMed:20389280, ECO:0000269|PubMed:21670212, ECO:0000269|PubMed:21840486, ECO:0000269|PubMed:22085717, ECO:0000269|PubMed:22358839, ECO:0000269|PubMed:22578813, ECO:0000269|PubMed:22632832, ECO:0000269|PubMed:23213400, ECO:0000269|PubMed:23387299, ECO:0000269|PubMed:23453970, ECO:0000269|PubMed:23455478, ECO:0000269|PubMed:23576762, ECO:0000269|PubMed:24768539, ECO:0000269|PubMed:25270598, ECO:0000269|PubMed:26399832, ECO:0000269|PubMed:27565346, ECO:0000269|PubMed:27716508, ECO:0000269|PubMed:27798626, ECO:0000269|PubMed:29769719}. | Q6PI48 Main function of 5'-partner protein: | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000264414, ENST00000344951, ENST00000409096, ENST00000409777, ENST00000432260, | ENST00000463008, ENST00000264161, ENST00000537273, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 12 X 12 X 7=1008 | 8 X 9 X 5=360 |
| # samples | 14 | 8 | |
| ** MAII score | log2(14/1008*10)=-2.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/360*10)=-2.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: CUL3 [Title/Abstract] AND DARS [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: CUL3 [Title/Abstract] AND DARS [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CUL3(225378241)-DARS(136670136), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | CUL3-DARS seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CUL3-DARS seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CUL3-DARS seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CUL3-DARS seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CUL3-DARS seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. CUL3-DARS seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. CUL3-DARS seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | CUL3 | GO:0000209 | protein polyubiquitination | 19261606 |
| Hgene | CUL3 | GO:0006511 | ubiquitin-dependent protein catabolic process | 25401743|27561354 |
| Hgene | CUL3 | GO:0006513 | protein monoubiquitination | 22358839 |
| Hgene | CUL3 | GO:0006888 | ER to Golgi vesicle-mediated transport | 22358839 |
| Hgene | CUL3 | GO:0016567 | protein ubiquitination | 17543862|19782033|19995937|20389280|23213400 |
| Hgene | CUL3 | GO:0031145 | anaphase-promoting complex-dependent catabolic process | 10500095 |
| Hgene | CUL3 | GO:0043161 | proteasome-mediated ubiquitin-dependent protein catabolic process | 19261606|19782033|20389280 |
| Hgene | CUL3 | GO:0071630 | nuclear protein quality control by the ubiquitin-proteasome system | 27561354 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:225378241/chr2:136670136) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across CUL3 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across DARS (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000264414 | CUL3 | chr2 | 225378241 | - | ENST00000264161 | DARS | chr2 | 136670136 | - | 1989 | 993 | 339 | 1349 | 336 |
| ENST00000264414 | CUL3 | chr2 | 225378241 | - | ENST00000537273 | DARS | chr2 | 136670136 | - | 1404 | 993 | 339 | 1349 | 336 |
| ENST00000344951 | CUL3 | chr2 | 225378241 | - | ENST00000264161 | DARS | chr2 | 136670136 | - | 1836 | 840 | 384 | 1196 | 270 |
| ENST00000344951 | CUL3 | chr2 | 225378241 | - | ENST00000537273 | DARS | chr2 | 136670136 | - | 1251 | 840 | 384 | 1196 | 270 |
| ENST00000409096 | CUL3 | chr2 | 225378241 | - | ENST00000264161 | DARS | chr2 | 136670136 | - | 1721 | 725 | 53 | 1081 | 342 |
| ENST00000409096 | CUL3 | chr2 | 225378241 | - | ENST00000537273 | DARS | chr2 | 136670136 | - | 1136 | 725 | 53 | 1081 | 342 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000264414 | ENST00000264161 | CUL3 | chr2 | 225378241 | - | DARS | chr2 | 136670136 | - | 0.000673067 | 0.99932694 |
| ENST00000264414 | ENST00000537273 | CUL3 | chr2 | 225378241 | - | DARS | chr2 | 136670136 | - | 0.001809187 | 0.9981908 |
| ENST00000344951 | ENST00000264161 | CUL3 | chr2 | 225378241 | - | DARS | chr2 | 136670136 | - | 0.000956877 | 0.99904305 |
| ENST00000344951 | ENST00000537273 | CUL3 | chr2 | 225378241 | - | DARS | chr2 | 136670136 | - | 0.002691174 | 0.99730885 |
| ENST00000409096 | ENST00000264161 | CUL3 | chr2 | 225378241 | - | DARS | chr2 | 136670136 | - | 0.000212479 | 0.9997875 |
| ENST00000409096 | ENST00000537273 | CUL3 | chr2 | 225378241 | - | DARS | chr2 | 136670136 | - | 0.000417496 | 0.99958247 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CUL3-DARS |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| CUL3 | chr2 | 225378241 | DARS | chr2 | 136670136 | 725 | 224 | EAPFLEMSAEFFQYDTDFYILDKYPL |
| CUL3 | chr2 | 225378241 | DARS | chr2 | 136670136 | 840 | 152 | EAPFLEMSAEFFQYDTDFYILDKYPL |
| CUL3 | chr2 | 225378241 | DARS | chr2 | 136670136 | 993 | 218 | EAPFLEMSAEFFQYDTDFYILDKYPL |
Top |
Potential FusionNeoAntigen Information of CUL3-DARS in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| CUL3-DARS_225378241_136670136.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:03 | FQYDTDFY | 0.926 | 0.8984 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-A02:04 | FQYDTDFYI | 0.9848 | 0.584 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:02 | EMSAEFFQY | 0.9572 | 0.9304 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:01 | EMSAEFFQY | 0.9106 | 0.8579 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B13:02 | FQYDTDFYI | 0.8891 | 0.7771 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B13:01 | FQYDTDFYI | 0.8409 | 0.9298 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B39:01 | FQYDTDFYI | 0.5266 | 0.8505 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B39:13 | FQYDTDFYI | 0.4849 | 0.8739 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B38:01 | FQYDTDFYI | 0.4512 | 0.9088 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B38:02 | FQYDTDFYI | 0.4257 | 0.9203 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B52:01 | FQYDTDFYI | 0.09 | 0.9029 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:03 | AEFFQYDTDF | 0.9966 | 0.9557 | 8 | 18 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:03 | LEMSAEFFQY | 0.9945 | 0.9664 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B18:01 | LEMSAEFFQY | 0.9798 | 0.8759 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B13:01 | FQYDTDFYIL | 0.913 | 0.941 | 11 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B13:02 | FFQYDTDFYI | 0.4696 | 0.7012 | 10 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:03 | AEFFQYDTDFY | 0.9992 | 0.9702 | 8 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:10 | QYDTDFYI | 0.9997 | 0.821 | 12 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:07 | QYDTDFYI | 0.9996 | 0.8659 | 12 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:05 | FQYDTDFY | 0.983 | 0.9127 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:14 | QYDTDFYI | 0.9654 | 0.7871 | 12 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:10 | QYDTDFYIL | 0.9949 | 0.856 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:07 | QYDTDFYIL | 0.9941 | 0.8985 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:06 | FQYDTDFYI | 0.9763 | 0.8299 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:21 | EMSAEFFQY | 0.9637 | 0.9055 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:05 | EMSAEFFQY | 0.9515 | 0.8178 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C12:04 | FQYDTDFYI | 0.9471 | 0.9943 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C06:03 | FQYDTDFYI | 0.9441 | 0.9943 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:31 | EMSAEFFQY | 0.922 | 0.8293 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:14 | FQYDTDFYI | 0.9126 | 0.7118 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C08:03 | FQYDTDFYI | 0.8495 | 0.979 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:29 | QYDTDFYIL | 0.7627 | 0.9312 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:13 | QYDTDFYIL | 0.7479 | 0.9471 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:10 | QYDTDFYIL | 0.7048 | 0.9696 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:29 | FQYDTDFYI | 0.7024 | 0.9072 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:13 | FQYDTDFYI | 0.6805 | 0.9238 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:80 | QYDTDFYIL | 0.6775 | 0.9578 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:67 | QYDTDFYIL | 0.6775 | 0.9578 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:27 | FQYDTDFYI | 0.5991 | 0.9604 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C02:06 | FQYDTDFYI | 0.5813 | 0.9502 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B39:09 | FQYDTDFYI | 0.5799 | 0.5785 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B39:12 | QYDTDFYIL | 0.5435 | 0.9232 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:14 | QYDTDFYIL | 0.5106 | 0.8132 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B39:05 | FQYDTDFYI | 0.3919 | 0.8416 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B51:07 | FQYDTDFYI | 0.0802 | 0.796 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:10 | FQYDTDFYIL | 0.9982 | 0.8973 | 11 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:07 | FQYDTDFYIL | 0.9979 | 0.9114 | 11 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:14 | FQYDTDFYIL | 0.9866 | 0.7332 | 11 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:01 | QYDTDFYI | 0.9996 | 0.8659 | 12 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C18:01 | QYDTDFYI | 0.9993 | 0.8851 | 12 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:53 | FQYDTDFY | 0.9953 | 0.9523 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:54 | FQYDTDFY | 0.9911 | 0.9407 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:20 | FQYDTDFY | 0.9835 | 0.9375 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:28 | FQYDTDFY | 0.9776 | 0.9431 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:20 | FQYDTDFY | 0.9635 | 0.9494 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B18:04 | FQYDTDFY | 0.9408 | 0.919 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B48:02 | FQYDTDFY | 0.7869 | 0.9281 | 11 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:01 | QYDTDFYIL | 0.9941 | 0.8985 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C18:01 | QYDTDFYIL | 0.9922 | 0.8935 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-A02:03 | FQYDTDFYI | 0.9838 | 0.5753 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:12 | EMSAEFFQY | 0.9829 | 0.8571 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:08 | EMSAEFFQY | 0.9726 | 0.8038 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-A25:01 | EMSAEFFQY | 0.9588 | 0.8959 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:04 | FQYDTDFYI | 0.9548 | 0.736 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:20 | EMSAEFFQY | 0.9518 | 0.8816 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C17:01 | FQYDTDFYI | 0.9208 | 0.7173 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:28 | EMSAEFFQY | 0.9193 | 0.8816 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:77 | EMSAEFFQY | 0.9106 | 0.8579 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:23 | EMSAEFFQY | 0.9079 | 0.8593 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:20 | EMSAEFFQY | 0.9011 | 0.9017 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:73 | FQYDTDFYI | 0.8837 | 0.9506 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C08:01 | FQYDTDFYI | 0.8495 | 0.979 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C06:02 | FQYDTDFYI | 0.841 | 0.9938 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C06:17 | FQYDTDFYI | 0.841 | 0.9938 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B35:24 | EMSAEFFQY | 0.7643 | 0.8715 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:13 | EMSAEFFQY | 0.7601 | 0.6372 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C06:06 | FQYDTDFYI | 0.7493 | 0.9819 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C03:06 | FQYDTDFYI | 0.7384 | 0.9916 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:04 | QYDTDFYIL | 0.6838 | 0.8253 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:17 | QYDTDFYIL | 0.6813 | 0.9696 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:02 | QYDTDFYIL | 0.6775 | 0.9578 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:04 | FQYDTDFYI | 0.6173 | 0.9124 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B39:02 | FQYDTDFYI | 0.5856 | 0.8706 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C07:04 | QYDTDFYIL | 0.5398 | 0.9343 | 12 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C06:08 | FQYDTDFYI | 0.5242 | 0.9922 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C02:02 | FQYDTDFYI | 0.5138 | 0.9693 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C02:10 | FQYDTDFYI | 0.5138 | 0.9693 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B38:05 | FQYDTDFYI | 0.4512 | 0.9088 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B18:04 | EMSAEFFQY | 0.4237 | 0.8406 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B18:07 | EMSAEFFQY | 0.24 | 0.783 | 5 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:09 | FQYDTDFYI | 0.0864 | 0.7069 | 11 | 20 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C14:03 | FFQYDTDFY | 0.0691 | 0.9651 | 10 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C14:02 | FFQYDTDFY | 0.0691 | 0.9651 | 10 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C04:01 | FQYDTDFYIL | 0.9979 | 0.9114 | 11 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-C18:01 | FQYDTDFYIL | 0.997 | 0.9112 | 11 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:13 | AEFFQYDTDF | 0.9966 | 0.9557 | 8 | 18 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:26 | AEFFQYDTDF | 0.9966 | 0.9557 | 8 | 18 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:07 | AEFFQYDTDF | 0.9966 | 0.9557 | 8 | 18 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:13 | LEMSAEFFQY | 0.9945 | 0.9664 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:07 | LEMSAEFFQY | 0.9945 | 0.9664 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:26 | LEMSAEFFQY | 0.9945 | 0.9664 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B18:08 | LEMSAEFFQY | 0.9869 | 0.8531 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B15:73 | FQYDTDFYIL | 0.9832 | 0.9283 | 11 | 21 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B18:05 | LEMSAEFFQY | 0.9798 | 0.8759 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B18:11 | LEMSAEFFQY | 0.9534 | 0.8674 | 4 | 14 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:26 | AEFFQYDTDFY | 0.9992 | 0.9702 | 8 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:07 | AEFFQYDTDFY | 0.9992 | 0.9702 | 8 | 19 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | HLA-B44:13 | AEFFQYDTDFY | 0.9992 | 0.9702 | 8 | 19 |
Top |
Potential FusionNeoAntigen Information of CUL3-DARS in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| CUL3-DARS_225378241_136670136.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB1-1222 | EAPFLEMSAEFFQYD | 0 | 15 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0101 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0101 | SAEFFQYDTDFYILD | 7 | 22 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0104 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0104 | SAEFFQYDTDFYILD | 7 | 22 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0105 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0105 | SAEFFQYDTDFYILD | 7 | 22 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0108 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0108 | SAEFFQYDTDFYILD | 7 | 22 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0109 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0111 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0111 | SAEFFQYDTDFYILD | 7 | 22 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0112 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0112 | SAEFFQYDTDFYILD | 7 | 22 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0113 | AEFFQYDTDFYILDK | 8 | 23 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0113 | SAEFFQYDTDFYILD | 7 | 22 |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 993 | DRB3-0114 | AEFFQYDTDFYILDK | 8 | 23 |
Top |
Fusion breakpoint peptide structures of CUL3-DARS |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 6009 | MSAEFFQYDTDFYI | CUL3 | DARS | chr2 | 225378241 | chr2 | 136670136 | 993 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CUL3-DARS |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 6009 | MSAEFFQYDTDFYI | -8.85616 | -8.96956 |
| HLA-B14:02 | 3BVN | 6009 | MSAEFFQYDTDFYI | -5.66423 | -6.69953 |
| HLA-B52:01 | 3W39 | 6009 | MSAEFFQYDTDFYI | -6.49489 | -6.60829 |
| HLA-B52:01 | 3W39 | 6009 | MSAEFFQYDTDFYI | -3.99785 | -5.03315 |
| HLA-A11:01 | 4UQ2 | 6009 | MSAEFFQYDTDFYI | -4.90759 | -5.94289 |
| HLA-A24:02 | 5HGA | 6009 | MSAEFFQYDTDFYI | -7.27887 | -7.39227 |
| HLA-A24:02 | 5HGA | 6009 | MSAEFFQYDTDFYI | -7.11524 | -8.15054 |
| HLA-B27:05 | 6PYJ | 6009 | MSAEFFQYDTDFYI | -6.11615 | -6.22955 |
| HLA-B27:05 | 6PYJ | 6009 | MSAEFFQYDTDFYI | -4.78818 | -5.82348 |
| HLA-B44:05 | 3DX8 | 6009 | MSAEFFQYDTDFYI | -7.22602 | -7.33942 |
| HLA-B44:05 | 3DX8 | 6009 | MSAEFFQYDTDFYI | -4.86671 | -5.90201 |
Top |
Vaccine Design for the FusionNeoAntigens of CUL3-DARS |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 10 | 19 | FFQYDTDFY | TTTTTTCAGTATGATACAGATTTTTAT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 10 | 20 | FFQYDTDFYI | TTTTTTCAGTATGATACAGATTTTTATATT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 11 | 19 | FQYDTDFY | TTTCAGTATGATACAGATTTTTAT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 11 | 20 | FQYDTDFYI | TTTCAGTATGATACAGATTTTTATATT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 11 | 21 | FQYDTDFYIL | TTTCAGTATGATACAGATTTTTATATTCTT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 12 | 20 | QYDTDFYI | CAGTATGATACAGATTTTTATATT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 12 | 21 | QYDTDFYIL | CAGTATGATACAGATTTTTATATTCTT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 4 | 14 | LEMSAEFFQY | TTGGAAATGTCTGCAGAATTTTTTCAGTAT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 5 | 14 | EMSAEFFQY | GAAATGTCTGCAGAATTTTTTCAGTAT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 8 | 18 | AEFFQYDTDF | GCAGAATTTTTTCAGTATGATACAGATTTT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 8 | 19 | AEFFQYDTDFY | GCAGAATTTTTTCAGTATGATACAGATTTTTAT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 0 | 15 | EAPFLEMSAEFFQYD | GAGGCTCCTTTTTTGGAAATGTCTGCAGAATTTTTTCAGTATGAT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 7 | 22 | SAEFFQYDTDFYILD | TCTGCAGAATTTTTTCAGTATGATACAGATTTTTATATTCTTGAT |
| CUL3-DARS | chr2 | 225378241 | chr2 | 136670136 | 8 | 23 | AEFFQYDTDFYILDK | GCAGAATTTTTTCAGTATGATACAGATTTTTATATTCTTGATAAA |
Top |
Information of the samples that have these potential fusion neoantigens of CUL3-DARS |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| KIRC | CUL3-DARS | chr2 | 225378241 | ENST00000264414 | chr2 | 136670136 | ENST00000264161 | TCGA-CJ-4636-01A |
Top |
Potential target of CAR-T therapy development for CUL3-DARS |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CUL3-DARS |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CUL3-DARS |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies