|
|||||||
|
Fusion Protein:CYP4A11-CYP4F3 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: CYP4A11-CYP4F3 | FusionPDB ID: 21080 | FusionGDB2.0 ID: 21080 | Hgene | Tgene | Gene symbol | CYP4A11 | CYP4F3 | Gene ID | 1579 | 4051 |
| Gene name | cytochrome P450 family 4 subfamily A member 11 | cytochrome P450 family 4 subfamily F member 3 | |
| Synonyms | CP4Y|CYP4A2|CYP4AII|CYPIVA11 | CPF3|CYP4F|CYPIVF3|LTB4H | |
| Cytomap | 1p33 | 19p13.12 | |
| Type of gene | protein-coding | protein-coding | |
| Description | cytochrome P450 4A1120-HETE synthase20-hydroxyeicosatetraenoic acid synthaseP450HL-omegaalkane-1 monooxygenasecytochrome P-450HK-omegacytochrome P450, family 4, subfamily A, polypeptide 11cytochrome P450, subfamily IVA, polypeptide 11cytochrome P4 | cytochrome P450 4F320-HETE synthase20-hydroxyeicosatetraenoic acid synthasecytochrome P-450cytochrome P450, family 4, subfamily F, polypeptide 3cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)cytochrome P450-LTB-omega | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q02928 Main function of 5'-partner protein: FUNCTION: A cytochrome P450 monooxygenase involved in the metabolism of fatty acids and their oxygenated derivatives (oxylipins) (PubMed:7679927, PubMed:1739747, PubMed:8914854, PubMed:10553002, PubMed:10660572, PubMed:15611369). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (CPR; NADPH-ferrihemoprotein reductase) (PubMed:7679927, PubMed:1739747, PubMed:8914854, PubMed:10553002, PubMed:10660572, PubMed:15611369). Catalyzes predominantly the oxidation of the terminal carbon (omega-oxidation) of saturated and unsaturated fatty acids, the catalytic efficiency decreasing in the following order: dodecanoic > tetradecanoic > (9Z)-octadecenoic > (9Z,12Z)-octadecadienoic > hexadecanoic acid (PubMed:10553002, PubMed:10660572). Acts as a major omega-hydroxylase for dodecanoic (lauric) acid in liver (PubMed:7679927, PubMed:1739747, PubMed:8914854, PubMed:15611369). Participates in omega-hydroxylation of (5Z,8Z,11Z,14Z)-eicosatetraenoic acid (arachidonate) to 20-hydroxyeicosatetraenoic acid (20-HETE), a signaling molecule acting both as vasoconstrictive and natriuretic with overall effect on arterial blood pressure (PubMed:10620324, PubMed:10660572, PubMed:15611369). Can also catalyze the oxidation of the penultimate carbon (omega-1 oxidation) of fatty acids with lower efficiency (PubMed:7679927). May contribute to the degradation of saturated very long-chain fatty acids (VLCFAs) such as docosanoic acid, by catalyzing successive omega-oxidations to the corresponding dicarboxylic acid, thereby initiating chain shortening (PubMed:18182499). Omega-hydroxylates (9R,10S)-epoxy-octadecanoate stereoisomer (PubMed:15145985). Plays a minor role in omega-oxidation of long-chain 3-hydroxy fatty acids (PubMed:18065749). Has little activity toward prostaglandins A1 and E1 (PubMed:7679927). {ECO:0000269|PubMed:10553002, ECO:0000269|PubMed:10620324, ECO:0000269|PubMed:10660572, ECO:0000269|PubMed:15145985, ECO:0000269|PubMed:15611369, ECO:0000269|PubMed:1739747, ECO:0000269|PubMed:18065749, ECO:0000269|PubMed:18182499, ECO:0000269|PubMed:7679927, ECO:0000269|PubMed:8914854}. | Q08477 Main function of 5'-partner protein: FUNCTION: A cytochrome P450 monooxygenase involved in the metabolism of various endogenous substrates, including fatty acids and their oxygenated derivatives (oxylipins) (PubMed:8486631, PubMed:9675028, PubMed:11461919, PubMed:15145985, PubMed:16547005, PubMed:16820285, PubMed:18182499, PubMed:18065749, PubMed:18577768). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (CPR; NADPH-ferrihemoprotein reductase) (PubMed:9675028). May play a role in inactivation of proinflammatory and anti-inflammatory oxylipins during the resolution of inflammation (PubMed:8486631, PubMed:9675028, PubMed:11461919, PubMed:15145985, PubMed:15364545, PubMed:16547005, PubMed:16820285, PubMed:18182499, PubMed:18065749, PubMed:18577768). {ECO:0000269|PubMed:11461919, ECO:0000269|PubMed:15145985, ECO:0000269|PubMed:15364545, ECO:0000269|PubMed:16547005, ECO:0000269|PubMed:16820285, ECO:0000269|PubMed:18065749, ECO:0000269|PubMed:18182499, ECO:0000269|PubMed:18577768, ECO:0000269|PubMed:8486631, ECO:0000269|PubMed:9675028}.; FUNCTION: [Isoform CYP4F3A]: Catalyzes predominantly the oxidation of the terminal carbon (omega-oxidation) of oxylipins in myeloid cells, displaying higher affinity for arachidonate metabolite leukotriene B4 (LTB4) (PubMed:8486631, PubMed:9675028, PubMed:11461919, PubMed:15364545). Inactivates LTB4 via three successive oxidative transformations to 20-hydroxy-LTB4, then to 20-oxo-LTB4 and to 20-carboxy-LTB4 (PubMed:9675028). Has omega-hydroxylase activity toward long-chain fatty acid epoxides with preference for 8,9-epoxy-(5Z,11Z,14Z)-eicosatrienoate (EET) and 9,10-epoxyoctadecanoate (PubMed:15145985). Omega-hydroxylates monohydroxy polyunsaturated fatty acids (PUFAs), including hydroxyeicosatetraenoates (HETEs) and hydroxyeicosapentaenoates (HEPEs), to dihydroxy compounds (PubMed:15364545, PubMed:9675028). Contributes to the degradation of saturated very long-chain fatty acids (VLCFAs) such as docosanoic acid, by catalyzing successive omega-oxidations to the corresponding dicarboxylic acid, thereby initiating chain shortening (PubMed:18182499). Has low hydroxylase activity toward PUFAs (PubMed:18577768, PubMed:11461919). {ECO:0000269|PubMed:11461919, ECO:0000269|PubMed:15145985, ECO:0000269|PubMed:15364545, ECO:0000269|PubMed:18182499, ECO:0000269|PubMed:18577768, ECO:0000269|PubMed:8486631, ECO:0000269|PubMed:9675028}.; FUNCTION: [Isoform CYP4F3B]: Catalyzes predominantly the oxidation of the terminal carbon (omega-oxidation) of polyunsaturated fatty acids (PUFAs) (PubMed:11461919, PubMed:16820285, PubMed:18577768). Participates in the conversion of arachidonic acid to 20-hydroxyeicosatetraenoic acid (20-HETE), a signaling molecule acting both as vasoconstrictive and natriuretic with overall effect on arterial blood pressure (PubMed:11461919, PubMed:16820285, PubMed:18577768). Has high omega-hydroxylase activity toward other PUFAs, including eicosatrienoic acid (ETA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) (PubMed:16820285, PubMed:18577768). Can also catalyze the oxidation of the penultimate carbon (omega-1 oxidation) of PUFAs with lower efficiency (PubMed:18577768). Contributes to the degradation of saturated very long-chain fatty acids (VLCFAs) such as docosanoic acid and hexacosanoic acid, by catalyzing successive omega-oxidations to the corresponding dicarboxylic acids, thereby initiating chain shortening (PubMed:16547005, PubMed:18182499). Omega-hydroxylates long-chain 3-hydroxy fatty acids, likely initiating the oxidative conversion to the corresponding 3-hydroxydicarboxylic fatty acids (PubMed:18065749). Has omega-hydroxylase activity toward long-chain fatty acid epoxides with preference for 8,9-epoxy-(5Z,11Z,14Z)-eicosatrienoate (EET) and 9,10-epoxyoctadecanoate (PubMed:15145985). {ECO:0000269|PubMed:11461919, ECO:0000269|PubMed:15145985, ECO:0000269|PubMed:16547005, ECO:0000269|PubMed:16820285, ECO:0000269|PubMed:18065749, ECO:0000269|PubMed:18182499, ECO:0000269|PubMed:18577768}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000310638, ENST00000371904, ENST00000371905, ENST00000457840, ENST00000462347, ENST00000496519, | ENST00000588886, ENST00000221307, ENST00000585846, ENST00000586182, ENST00000591058, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 3 X 3 X 2=18 | 4 X 4 X 4=64 |
| # samples | 3 | 4 | |
| ** MAII score | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(4/64*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: CYP4A11 [Title/Abstract] AND CYP4F3 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: CYP4A11 [Title/Abstract] AND CYP4F3 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CYP4A11(47400124)-CYP4F3(15763632), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | CYP4A11-CYP4F3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CYP4A11-CYP4F3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CYP4A11-CYP4F3 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. CYP4A11-CYP4F3 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | CYP4A11 | GO:0001676 | long-chain fatty acid metabolic process | 18433732 |
| Hgene | CYP4A11 | GO:0006691 | leukotriene metabolic process | 9799565 |
| Hgene | CYP4A11 | GO:0019369 | arachidonic acid metabolic process | 10660572 |
| Hgene | CYP4A11 | GO:0019373 | epoxygenase P450 pathway | 9618440 |
| Hgene | CYP4A11 | GO:0055114 | oxidation-reduction process | 9618440|9799565|18433732 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:47400124/chr19:15763632) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across CYP4A11 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across CYP4F3 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000462347 | CYP4A11 | chr1 | 47400124 | - | ENST00000586182 | CYP4F3 | chr19 | 15763632 | + | 2092 | 773 | 31 | 1350 | 439 |
| ENST00000462347 | CYP4A11 | chr1 | 47400124 | - | ENST00000591058 | CYP4F3 | chr19 | 15763632 | + | 2724 | 773 | 31 | 1350 | 439 |
| ENST00000462347 | CYP4A11 | chr1 | 47400124 | - | ENST00000221307 | CYP4F3 | chr19 | 15763632 | + | 4791 | 773 | 31 | 1350 | 439 |
| ENST00000462347 | CYP4A11 | chr1 | 47400124 | - | ENST00000585846 | CYP4F3 | chr19 | 15763632 | + | 1737 | 773 | 31 | 1350 | 439 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000462347 | ENST00000586182 | CYP4A11 | chr1 | 47400124 | - | CYP4F3 | chr19 | 15763632 | + | 0.06931838 | 0.93068165 |
| ENST00000462347 | ENST00000591058 | CYP4A11 | chr1 | 47400124 | - | CYP4F3 | chr19 | 15763632 | + | 0.031760946 | 0.968239 |
| ENST00000462347 | ENST00000221307 | CYP4A11 | chr1 | 47400124 | - | CYP4F3 | chr19 | 15763632 | + | 0.007139117 | 0.99286085 |
| ENST00000462347 | ENST00000585846 | CYP4A11 | chr1 | 47400124 | - | CYP4F3 | chr19 | 15763632 | + | 0.09432569 | 0.9056743 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CYP4A11-CYP4F3 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| CYP4A11 | chr1 | 47400124 | CYP4F3 | chr19 | 15763632 | 773 | 122 | GRSDPKSHGSYRFLAPWIGYGLLLLN |
| CYP4A11 | chr1 | 47400124 | CYP4F3 | chr19 | 15763632 | 773 | 127 | KSHGSYRFLAPWIGYGLLLLNGQTWF |
Top |
Potential FusionNeoAntigen Information of CYP4A11-CYP4F3 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| CYP4A11-CYP4F3_47400124_15763632.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B81:01 | APWIGYGLL | 0.126 | 0.5996 | 9 | 18 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B82:01 | APWIGYGLL | 0.1056 | 0.6512 | 9 | 18 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:05 | YRFLAPWIGY | 1 | 0.8647 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:02 | YRFLAPWIGY | 1 | 0.5382 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:04 | YRFLAPWIGY | 0.9999 | 0.6119 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-A02:13 | FLAPWIGYGL | 0.9937 | 0.5489 | 7 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-A02:04 | FLAPWIGYGL | 0.9926 | 0.7553 | 7 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-A02:17 | FLAPWIGYGL | 0.9909 | 0.6436 | 7 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-A02:19 | FLAPWIGYGL | 0.979 | 0.503 | 7 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-A02:38 | FLAPWIGYGL | 0.9779 | 0.5479 | 7 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B15:18 | YRFLAPWIGY | 0.8641 | 0.5655 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B81:01 | APWIGYGLLL | 0.7585 | 0.6656 | 9 | 19 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B82:01 | APWIGYGLLL | 0.6421 | 0.7237 | 9 | 19 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B73:01 | YRFLAPWIG | 0.953 | 0.8856 | 5 | 14 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C01:30 | LAPWIGYGL | 0.7001 | 0.9563 | 8 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C01:17 | LAPWIGYGL | 0.5954 | 0.9612 | 8 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B42:02 | APWIGYGLL | 0.2986 | 0.9309 | 9 | 18 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B42:01 | APWIGYGLL | 0.2472 | 0.9265 | 9 | 18 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:14 | YRFLAPWIGY | 0.9999 | 0.7737 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:03 | YRFLAPWIGY | 0.9995 | 0.8769 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:95 | YRFLAPWIGY | 0.9989 | 0.5801 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:05 | YRFLAPWIGY | 0.9988 | 0.9564 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:27 | YRFLAPWIGY | 0.9987 | 0.9364 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-A02:05 | FLAPWIGYGL | 0.9974 | 0.5214 | 7 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:19 | YRFLAPWIGY | 0.9922 | 0.5609 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:67 | YRFLAPWIGY | 0.9886 | 0.8959 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:80 | YRFLAPWIGY | 0.9886 | 0.8959 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:46 | YRFLAPWIGY | 0.9866 | 0.7517 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:10 | YRFLAPWIGY | 0.9862 | 0.9499 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C12:16 | YRFLAPWIGY | 0.8142 | 0.9635 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B42:01 | APWIGYGLLL | 0.6277 | 0.9449 | 9 | 19 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B67:01 | APWIGYGLL | 0.7345 | 0.8921 | 9 | 18 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C01:02 | LAPWIGYGL | 0.5816 | 0.9617 | 8 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C01:03 | LAPWIGYGL | 0.4632 | 0.8339 | 8 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B82:02 | APWIGYGLL | 0.1056 | 0.6512 | 9 | 18 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:10 | YRFLAPWIGY | 0.9999 | 0.8028 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:08 | YRFLAPWIGY | 0.9999 | 0.7288 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:01 | YRFLAPWIGY | 0.9992 | 0.5141 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B27:09 | YRFLAPWIGY | 0.9991 | 0.7841 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-A02:03 | FLAPWIGYGL | 0.9974 | 0.5488 | 7 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:02 | YRFLAPWIGY | 0.9886 | 0.8959 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-C07:22 | YRFLAPWIGY | 0.9686 | 0.6633 | 5 | 15 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B67:01 | APWIGYGLLL | 0.7833 | 0.928 | 9 | 19 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | HLA-B82:02 | APWIGYGLLL | 0.6421 | 0.7237 | 9 | 19 |
Top |
Potential FusionNeoAntigen Information of CYP4A11-CYP4F3 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| CYP4A11-CYP4F3_47400124_15763632.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0101 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0101 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0103 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0105 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0105 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0107 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0107 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0109 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0109 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0111 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0111 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0113 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0113 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0115 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0115 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0117 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0117 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0119 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0119 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0121 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0121 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0125 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0125 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0127 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0127 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0129 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0129 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0131 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-0131 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-1001 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-1001 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-1003 | SHGSYRFLAPWIGYG | 1 | 16 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-1003 | HGSYRFLAPWIGYGL | 2 | 17 |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 | DRB1-1609 | SHGSYRFLAPWIGYG | 1 | 16 |
Top |
Fusion breakpoint peptide structures of CYP4A11-CYP4F3 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 7832 | RFLAPWIGYGLLLL | CYP4A11 | CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 773 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CYP4A11-CYP4F3 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 7832 | RFLAPWIGYGLLLL | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 7832 | RFLAPWIGYGLLLL | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 7832 | RFLAPWIGYGLLLL | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 7832 | RFLAPWIGYGLLLL | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 7832 | RFLAPWIGYGLLLL | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 7832 | RFLAPWIGYGLLLL | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 7832 | RFLAPWIGYGLLLL | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 7832 | RFLAPWIGYGLLLL | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 7832 | RFLAPWIGYGLLLL | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 7832 | RFLAPWIGYGLLLL | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 7832 | RFLAPWIGYGLLLL | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of CYP4A11-CYP4F3 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 5 | 14 | YRFLAPWIG | CTGGATATCCTCCTCTTGGCCAAAGCC |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 5 | 15 | YRFLAPWIGY | CTGGATATCCTCCTCTTGGCCAAAGCCATG |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 7 | 17 | FLAPWIGYGL | ATCCTCCTCTTGGCCAAAGCCATGACACCA |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 8 | 17 | LAPWIGYGL | CTCCTCTTGGCCAAAGCCATGACACCA |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 9 | 18 | APWIGYGLL | CTCTTGGCCAAAGCCATGACACCACAG |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 9 | 19 | APWIGYGLLL | CTCTTGGCCAAAGCCATGACACCACAGCCA |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 1 | 16 | SHGSYRFLAPWIGYG | CATTTGGATTTTCTGGATATCCTCCTCTTGGCCAAAGCCATGACA |
| CYP4A11-CYP4F3 | chr1 | 47400124 | chr19 | 15763632 | 2 | 17 | HGSYRFLAPWIGYGL | TTGGATTTTCTGGATATCCTCCTCTTGGCCAAAGCCATGACACCA |
Top |
Information of the samples that have these potential fusion neoantigens of CYP4A11-CYP4F3 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| Non-Cancer | CYP4A11-CYP4F3 | chr1 | 47400124 | ENST00000462347 | chr19 | 15763632 | ENST00000221307 | TCGA-BQ-5879-11A |
Top |
Potential target of CAR-T therapy development for CYP4A11-CYP4F3 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CYP4A11-CYP4F3 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CYP4A11-CYP4F3 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies