![]() |
|||||||
|
Fusion Protein:CYP4F11-CIB3 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: CYP4F11-CIB3 | FusionPDB ID: 21089 | FusionGDB2.0 ID: 21089 | Hgene | Tgene | Gene symbol | CYP4F11 | CIB3 | Gene ID | 57834 | 117286 |
Gene name | cytochrome P450 family 4 subfamily F member 11 | calcium and integrin binding family member 3 | |
Synonyms | CYPIVF11 | KIP3 | |
Cytomap | 19p13.12 | 19p13.11 | |
Type of gene | protein-coding | protein-coding | |
Description | cytochrome P450 4F113-hydroxy fatty acids omega-hydroxylase CYP4F11cytochrome P450, family 4, subfamily F, polypeptide 11cytochrome P450, subfamily IVF, polypeptide 11docosahexaenoic acid omega-hydroxylaselong-chain fatty acid omega-monooxygenasephy | calcium and integrin-binding family member 3DNA-dependent protein kinase catalytic subunit-interacting protein 3 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q9HBI6 Main function of 5'-partner protein: FUNCTION: A cytochrome P450 monooxygenase involved in the metabolism of various endogenous substrates, including fatty acids and their oxygenated derivatives (oxylipins) (PubMed:24138531, PubMed:15364545, PubMed:18065749). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (CPR; NADPH-ferrihemoprotein reductase) (PubMed:15364545, PubMed:18065749, PubMed:24138531). Catalyzes with high efficiency the oxidation of the terminal carbon (omega-oxidation) of 3-hydroxy fatty acids, such as 3-hydroxyhexadecanoic and 3-hydroxyoctadecanoic acids, likely participating in the biosynthesis of long-chain 3-hydroxydicarboxylic acids (PubMed:18065749, PubMed:19932081). Omega-hydroxylates and inactivates phylloquinone (vitamin K1), and menaquinone-4 (MK-4, a form of vitamin K2), both acting as cofactors in blood coagulation (PubMed:24138531). Metabolizes with low efficiciency fatty acids, including (5Z,8Z,11Z,14Z)-eicosatetraenoic acid (arachidonate) and its oxygenated metabolite 8-hydroxyeicosatetraenoic acid (8-HETE) (PubMed:15364545, PubMed:19932081). Catalyzes N- and O-demethylation of drugs such as erythromycin, benzphetamine, ethylmorphine, chlorpromazine, imipramine and verapamil (PubMed:15364545). {ECO:0000269|PubMed:15364545, ECO:0000269|PubMed:18065749, ECO:0000269|PubMed:19932081, ECO:0000269|PubMed:24138531}. | Q96Q77 Main function of 5'-partner protein: | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000248041, ENST00000326742, ENST00000402119, ENST00000591841, | ENST00000541493, ENST00000269878, ENST00000379859, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 2 X 2=8 | 6 X 5 X 5=150 |
# samples | 2 | 9 | |
** MAII score | log2(2/8*10)=1.32192809488736 | log2(9/150*10)=-0.736965594166206 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: CYP4F11 [Title/Abstract] AND CIB3 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: CYP4F11 [Title/Abstract] AND CIB3 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CYP4F11(16045021)-CIB3(16275724), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | CYP4F11-CIB3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CYP4F11-CIB3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CYP4F11-CIB3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CYP4F11-CIB3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CYP4F11-CIB3 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. CYP4F11-CIB3 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | CYP4F11 | GO:0006631 | fatty acid metabolic process | 18065749 |
Hgene | CYP4F11 | GO:0042361 | menaquinone catabolic process | 24138531 |
Hgene | CYP4F11 | GO:0042376 | phylloquinone catabolic process | 24138531 |
Hgene | CYP4F11 | GO:0042377 | vitamin K catabolic process | 24138531 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:16045021/chr19:16275724) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000248041 | CYP4F11 | chr19 | 16045021 | - | ENST00000269878 | CIB3 | chr19 | 16275724 | - | 550 | 235 | 168 | 452 | 94 |
ENST00000248041 | CYP4F11 | chr19 | 16045021 | - | ENST00000379859 | CIB3 | chr19 | 16275724 | - | 503 | 235 | 168 | 452 | 94 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000248041 | ENST00000269878 | CYP4F11 | chr19 | 16045021 | - | CIB3 | chr19 | 16275724 | - | 0.26015666 | 0.7398433 |
ENST00000248041 | ENST00000379859 | CYP4F11 | chr19 | 16045021 | - | CIB3 | chr19 | 16275724 | - | 0.24251868 | 0.75748134 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CYP4F11-CIB3 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
CYP4F11 | chr19 | 16045021 | CIB3 | chr19 | 16275724 | 235 | 22 | TPETELVLGTPGPDFNNDDYICAWDL |
Top |
Potential FusionNeoAntigen Information of CYP4F11-CIB3 in HLA I |
![]() |
CYP4F11-CIB3_16045021_16275724.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CYP4F11-CIB3 | chr19 | 16045021 | chr19 | 16275724 | 235 | HLA-B35:08 | GPDFNNDDY | 0.899 | 0.7941 | 11 | 20 |
CYP4F11-CIB3 | chr19 | 16045021 | chr19 | 16275724 | 235 | HLA-B35:08 | TPGPDFNNDDY | 0.9888 | 0.8659 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of CYP4F11-CIB3 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of CYP4F11-CIB3 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
10075 | VLGTPGPDFNNDDY | CYP4F11 | CIB3 | chr19 | 16045021 | chr19 | 16275724 | 235 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CYP4F11-CIB3 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 10075 | VLGTPGPDFNNDDY | -7.79586 | -7.90926 |
HLA-B14:02 | 3BVN | 10075 | VLGTPGPDFNNDDY | -6.21801 | -7.25331 |
HLA-B52:01 | 3W39 | 10075 | VLGTPGPDFNNDDY | -6.72741 | -6.84081 |
HLA-B52:01 | 3W39 | 10075 | VLGTPGPDFNNDDY | -4.3752 | -5.4105 |
HLA-A11:01 | 4UQ2 | 10075 | VLGTPGPDFNNDDY | -6.25337 | -6.36677 |
HLA-A24:02 | 5HGA | 10075 | VLGTPGPDFNNDDY | -8.19416 | -8.30756 |
HLA-A24:02 | 5HGA | 10075 | VLGTPGPDFNNDDY | -5.08938 | -6.12468 |
HLA-B27:05 | 6PYJ | 10075 | VLGTPGPDFNNDDY | -7.6632 | -7.7766 |
HLA-B44:05 | 3DX8 | 10075 | VLGTPGPDFNNDDY | -6.89178 | -7.92708 |
HLA-B44:05 | 3DX8 | 10075 | VLGTPGPDFNNDDY | -5.39929 | -5.51269 |
HLA-B35:01 | 1A1N | 10075 | VLGTPGPDFNNDDY | -5.68291 | -6.71821 |
HLA-B35:01 | 1A1N | 10075 | VLGTPGPDFNNDDY | -5.62106 | -5.73446 |
Top |
Vaccine Design for the FusionNeoAntigens of CYP4F11-CIB3 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
CYP4F11-CIB3 | chr19 | 16045021 | chr19 | 16275724 | 11 | 20 | GPDFNNDDY | GGCCTGATTTTAACAACGACGACTACA |
CYP4F11-CIB3 | chr19 | 16045021 | chr19 | 16275724 | 9 | 20 | TPGPDFNNDDY | CACCAGGGCCTGATTTTAACAACGACGACTACA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of CYP4F11-CIB3 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
CESC | CYP4F11-CIB3 | chr19 | 16045021 | ENST00000248041 | chr19 | 16275724 | ENST00000269878 | TCGA-EK-A2PM-01A |
Top |
Potential target of CAR-T therapy development for CYP4F11-CIB3 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | CYP4F11 | chr19:16045021 | chr19:16275724 | ENST00000248041 | - | 2 | 13 | 15_37 | 66 | 525.0 | Transmembrane | Helical |
Hgene | CYP4F11 | chr19:16045021 | chr19:16275724 | ENST00000402119 | - | 1 | 12 | 15_37 | 66 | 525.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CYP4F11-CIB3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CYP4F11-CIB3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |