Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DCAF6-PBX1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DCAF6-PBX1
	FusionPDB ID: 21525
	FusionGDB2.0 ID: 21525
		Hgene	Tgene
	Gene symbol	DCAF6	PBX1
	Gene ID	55827	5087
	Gene name	DDB1 and CUL4 associated factor 6	PBX homeobox 1
	Synonyms	1200006M05Rik\|ARCAP\|IQWD1\|MSTP055\|NRIP\|PC326	CAKUHED
	Cytomap	1q24.2	1q23.3
	Type of gene	protein-coding	protein-coding
	Description	DDB1- and CUL4-associated factor 6IQ motif and WD repeat-containing protein 1IQ motif and WD repeats 1androgen receptor complex-associated proteinnuclear receptor interaction protein	pre-B-cell leukemia transcription factor 1homeobox protein PBX1homeobox protein PRLpre-B-cell leukemia homeobox 1
	Modification date	20200313	20200313
	UniProtAcc	Q58WW2 Main function of 5'-partner protein: FUNCTION: Ligand-dependent coactivator of nuclear receptors. Enhance transcriptional activity of the nuclear receptors NR3C1 and AR. May function as a substrate receptor for CUL4-DDB1 E3 ubiquitin-protein ligase complex. {ECO:0000269\|PubMed:15784617, ECO:0000269\|PubMed:16949367, ECO:0000269\|PubMed:16964240}.	P40424 Main function of 5'-partner protein: FUNCTION: Transcription factor which binds the DNA sequence 5'-TGATTGAT-3' as part of a heterodimer with HOX proteins such as HOXA1, HOXA5, HOXB7 and HOXB8 (PubMed:9191052). Binds to the DNA sequence 5'-TGATTGAC-3' in complex with a nuclear factor which is not a class I HOX protein (PubMed:9191052). Has also been shown to bind the DNA sequence 5'-ATCAATCAA-3' cooperatively with HOXA5, HOXB7, HOXB8, HOXC8 and HOXD4 (PubMed:8327485, PubMed:7791786). Acts as a transcriptional activator of PF4 in complex with MEIS1 (PubMed:12609849). Also activates transcription of SOX3 in complex with MEIS1 by binding to the 5'-TGATTGAC-3' consensus sequence (By similarity). In natural killer cells, binds to the NFIL3 promoter and acts as a transcriptional activator of NFIL3, promoting natural killer cell development (By similarity). Plays a role in the cAMP-dependent regulation of CYP17A1 gene expression via its cAMP-regulatory sequence (CRS1) (By similarity). Probably in complex with MEIS2, involved in transcriptional regulation by KLF4 (PubMed:21746878). Acts as a transcriptional activator of NKX2-5 and a transcriptional repressor of CDKN2B (By similarity). Together with NKX2-5, required for spleen development through a mechanism that involves CDKN2B repression (By similarity). {ECO:0000250\|UniProtKB:P41778, ECO:0000269\|PubMed:12609849, ECO:0000269\|PubMed:21746878, ECO:0000269\|PubMed:7791786, ECO:0000269\|PubMed:8327485, ECO:0000269\|PubMed:9191052}.; FUNCTION: [Isoform PBX1b]: As part of a PDX1:PBX1b:MEIS2B complex in pancreatic acinar cells, is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. {ECO:0000250\|UniProtKB:P41778}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000312263, ENST00000367840, ENST00000367843, ENST00000432587, ENST00000470919,	ENST00000560641, ENST00000474046, ENST00000485769, ENST00000540246, ENST00000367897, ENST00000401534, ENST00000420696, ENST00000540236, ENST00000559240,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 10 X 8=1040	13 X 13 X 8=1352
	# samples	17	17
	** MAII score	log2(17/1040*10)=-2.61297687689075 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(17/1352*10)=-2.99148850014448 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: DCAF6 [Title/Abstract] AND PBX1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DCAF6 [Title/Abstract] AND PBX1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DCAF6(167974031)-PBX1(164761730), # samples:1
Anticipated loss of major functional domain due to fusion event.	DCAF6-PBX1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DCAF6-PBX1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DCAF6-PBX1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DCAF6-PBX1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:167974031/chr1:164761730)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DCAF6 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PBX1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000367843	DCAF6	chr1	167974031	+	ENST00000420696	PBX1	chr1	164761730	+	7812	1629	251	2656	801
ENST00000367843	DCAF6	chr1	167974031	+	ENST00000401534	PBX1	chr1	164761730	+	2408	1629	251	2407	719
ENST00000367843	DCAF6	chr1	167974031	+	ENST00000559240	PBX1	chr1	164761730	+	2384	1629	251	2383	711
ENST00000367843	DCAF6	chr1	167974031	+	ENST00000367897	PBX1	chr1	164761730	+	2823	1629	251	2407	718
ENST00000367843	DCAF6	chr1	167974031	+	ENST00000540236	PBX1	chr1	164761730	+	2627	1629	251	2626	792
ENST00000432587	DCAF6	chr1	167974031	+	ENST00000420696	PBX1	chr1	164761730	+	7681	1498	213	2525	770
ENST00000432587	DCAF6	chr1	167974031	+	ENST00000401534	PBX1	chr1	164761730	+	2277	1498	213	2276	687
ENST00000432587	DCAF6	chr1	167974031	+	ENST00000559240	PBX1	chr1	164761730	+	2253	1498	213	2252	679
ENST00000432587	DCAF6	chr1	167974031	+	ENST00000367897	PBX1	chr1	164761730	+	2692	1498	213	2276	687
ENST00000432587	DCAF6	chr1	167974031	+	ENST00000540236	PBX1	chr1	164761730	+	2496	1498	213	2495	760
ENST00000312263	DCAF6	chr1	167974031	+	ENST00000420696	PBX1	chr1	164761730	+	7765	1582	204	2609	801
ENST00000312263	DCAF6	chr1	167974031	+	ENST00000401534	PBX1	chr1	164761730	+	2361	1582	204	2360	718
ENST00000312263	DCAF6	chr1	167974031	+	ENST00000559240	PBX1	chr1	164761730	+	2337	1582	204	2336	710
ENST00000312263	DCAF6	chr1	167974031	+	ENST00000367897	PBX1	chr1	164761730	+	2776	1582	204	2360	718
ENST00000312263	DCAF6	chr1	167974031	+	ENST00000540236	PBX1	chr1	164761730	+	2580	1582	204	2579	791
ENST00000367840	DCAF6	chr1	167974031	+	ENST00000420696	PBX1	chr1	164761730	+	7655	1472	94	2499	801
ENST00000367840	DCAF6	chr1	167974031	+	ENST00000401534	PBX1	chr1	164761730	+	2251	1472	94	2250	719
ENST00000367840	DCAF6	chr1	167974031	+	ENST00000559240	PBX1	chr1	164761730	+	2227	1472	94	2226	711
ENST00000367840	DCAF6	chr1	167974031	+	ENST00000367897	PBX1	chr1	164761730	+	2666	1472	94	2250	718
ENST00000367840	DCAF6	chr1	167974031	+	ENST00000540236	PBX1	chr1	164761730	+	2470	1472	94	2469	792

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000367843	ENST00000420696	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.000394943	0.9996051
ENST00000367843	ENST00000401534	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.002780158	0.9972198
ENST00000367843	ENST00000559240	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.003946764	0.9960532
ENST00000367843	ENST00000367897	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.002853606	0.9971464
ENST00000367843	ENST00000540236	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.002128557	0.9978714
ENST00000432587	ENST00000420696	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.000363516	0.9996364
ENST00000432587	ENST00000401534	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.003471909	0.9965281
ENST00000432587	ENST00000559240	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.005774919	0.9942251
ENST00000432587	ENST00000367897	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.003457349	0.99654263
ENST00000432587	ENST00000540236	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.003107236	0.9968927
ENST00000312263	ENST00000420696	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.000404262	0.9995957
ENST00000312263	ENST00000401534	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.003171314	0.9968286
ENST00000312263	ENST00000559240	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.004530086	0.9954699
ENST00000312263	ENST00000367897	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.003230918	0.9967691
ENST00000312263	ENST00000540236	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.002409798	0.9975902
ENST00000367840	ENST00000420696	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.00038075	0.99961925
ENST00000367840	ENST00000401534	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.002839343	0.9971607
ENST00000367840	ENST00000559240	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.004012401	0.9959876
ENST00000367840	ENST00000367897	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.002971513	0.9970285
ENST00000367840	ENST00000540236	DCAF6	chr1	167974031	+	PBX1	chr1	164761730	+	0.00215759	0.99784243

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DCAF6-PBX1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DCAF6	chr1	167974031	PBX1	chr1	164761730	1472	459	SVEASGHHTHHQSVLSIRGAQEEEPT
DCAF6	chr1	167974031	PBX1	chr1	164761730	1498	428	SVEASGHHTHHQSVLSIRGAQEEEPT
DCAF6	chr1	167974031	PBX1	chr1	164761730	1582	459	SVEASGHHTHHQSVLSIRGAQEEEPT
DCAF6	chr1	167974031	PBX1	chr1	164761730	1629	459	SVEASGHHTHHQSVLSIRGAQEEEPT

Top

Potential FusionNeoAntigen Information of DCAF6-PBX1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DCAF6-PBX1_167974031_164761730.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:24	HHTHHQSV	0.9997	0.7078	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	HHQSVLSI	0.9997	0.7919	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	HHTHHQSV	0.9997	0.9121	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:01	HHQSVLSI	0.9996	0.864	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:01	HHQSVLSI	0.9995	0.916	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:02	HHQSVLSI	0.9994	0.9377	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:01	HHTHHQSV	0.9993	0.903	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:01	HHQSVLSI	0.9986	0.762	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:02	HHQSVLSI	0.9986	0.762	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:02	HHTHHQSV	0.9984	0.9085	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:10	HHQSVLSI	0.9984	0.5013	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:01	HHTHHQSV	0.9984	0.9085	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:10	HHTHHQSV	0.9956	0.6313	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:37	HHQSVLSI	0.9751	0.5258	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:37	HHTHHQSV	0.9323	0.6374	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:01	HHTHHQSVL	0.9994	0.9203	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:01	THHQSVLSI	0.9991	0.8025	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	THHQSVLSI	0.9991	0.7283	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:24	HHTHHQSVL	0.9989	0.7035	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:13	HHTHHQSVL	0.9987	0.9354	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:01	THHQSVLSI	0.9986	0.886	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:02	THHQSVLSI	0.9985	0.911	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:02	HHTHHQSVL	0.9985	0.9745	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:13	THHQSVLSI	0.9982	0.8339	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	HHTHHQSVL	0.9981	0.8322	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:01	HHTHHQSVL	0.9981	0.97	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:24	GHHTHHQSV	0.9979	0.7006	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:01	THHQSVLSI	0.9979	0.7574	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:02	THHQSVLSI	0.9979	0.7574	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	GHHTHHQSV	0.9971	0.9123	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:01	GHHTHHQSV	0.9966	0.9096	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:10	THHQSVLSI	0.9955	0.5092	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:01	GHHTHHQSV	0.9954	0.9641	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:02	GHHTHHQSV	0.9946	0.9655	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:10	HHTHHQSVL	0.9888	0.5934	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:01	GHHTHHQSV	0.9857	0.9087	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:02	GHHTHHQSV	0.9857	0.9087	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:02	HHTHHQSVL	0.9856	0.8582	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:01	HHTHHQSVL	0.9856	0.8582	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:10	GHHTHHQSV	0.9422	0.6097	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:18	THHQSVLSI	0.8943	0.6591	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:18	HHTHHQSVL	0.8618	0.7427	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:37	HHTHHQSVL	0.8322	0.6515	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:18	GHHTHHQSV	0.6968	0.7663	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:37	GHHTHHQSV	0.6354	0.6029	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B52:01	THHQSVLSI	0.4768	0.847	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B48:01	HHTHHQSVL	0.2589	0.63	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B07:10	GHHTHHQSV	0.025	0.58	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B07:10	HHTHHQSVL	0.0188	0.6223	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:01	GHHTHHQSVL	0.9948	0.9222	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:24	GHHTHHQSVL	0.9943	0.722	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:02	GHHTHHQSVL	0.975	0.9681	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:10	GHHTHHQSVL	0.9659	0.6049	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:37	GHHTHHQSVL	0.8316	0.6016	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	SGHHTHHQSV	0.7778	0.9312	4	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	HTHHQSVLSI	0.7294	0.727	7	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B07:10	GHHTHHQSVL	0.5888	0.666	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:01	HTHHQSVLSI	0.3854	0.7977	7	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:01	HTHHQSVLSI	0.2722	0.8792	7	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:02	HTHHQSVLSI	0.2701	0.9026	7	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:01	HHTHHQSVLSI	0.9979	0.9168	6	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:02	HHTHHQSVLSI	0.9975	0.9363	6	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:06	HHQSVLSIRGA	0.9947	0.6481	9	20
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:10	SGHHTHHQSVL	0.881	0.5783	4	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:09	HHQSVLSI	0.9997	0.5454	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:09	HHTHHQSV	0.9995	0.8157	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:12	HHQSVLSI	0.9995	0.8665	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:05	HHQSVLSI	0.9992	0.843	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:12	HHTHHQSV	0.9989	0.9077	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:05	HHTHHQSV	0.9988	0.8891	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:03	HHTHHQSV	0.8855	0.8235	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:03	HHQSVLSI	0.8829	0.7247	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:09	HHTHHQSVL	0.9994	0.8166	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:09	THHQSVLSI	0.9993	0.5318	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:12	HHTHHQSVL	0.9992	0.9236	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:12	THHQSVLSI	0.999	0.806	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:05	HHTHHQSVL	0.9988	0.906	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:05	THHQSVLSI	0.9983	0.7994	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:09	GHHTHHQSV	0.9965	0.8605	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:12	GHHTHHQSV	0.9965	0.9124	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:05	GHHTHHQSV	0.9942	0.8989	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:27	THHQSVLSI	0.8921	0.9545	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:29	HHTHHQSVL	0.7962	0.9558	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:13	HHTHHQSVL	0.7909	0.9519	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:13	THHQSVLSI	0.7671	0.9301	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:29	THHQSVLSI	0.7404	0.9307	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:46	HHTHHQSVL	0.7125	0.9293	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:08	HHTHHQSVL	0.6868	0.9185	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:80	HHTHHQSVL	0.6801	0.9598	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:67	HHTHHQSVL	0.6801	0.9598	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:03	THHQSVLSI	0.5694	0.7018	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B73:01	THHQSVLSI	0.5203	0.6035	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:03	HHTHHQSVL	0.4043	0.8661	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B51:07	THHQSVLSI	0.3743	0.702	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B14:03	GHHTHHQSV	0.3596	0.8429	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C12:16	THHQSVLSI	0.0813	0.9569	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C12:16	HHTHHQSVL	0.034	0.9705	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:12	GHHTHHQSVL	0.9932	0.9245	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:05	GHHTHHQSVL	0.9756	0.911	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:05	HTHHQSVLSI	0.2206	0.7831	7	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-A31:01	HTHHQSVLSIR	0.9866	0.5412	7	18
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:31	HHQSVLSI	0.9996	0.8645	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:05	HHQSVLSI	0.9995	0.916	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:31	HHTHHQSV	0.9993	0.904	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	HHQSVLSI	0.9962	0.5234	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	HHTHHQSV	0.9895	0.7135	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:11	HHQSVLSI	0.9714	0.7189	9	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:11	HHTHHQSV	0.941	0.7483	6	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C16:01	HTHHQSVL	0.8294	0.9756	7	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:31	HHTHHQSVL	0.9994	0.9214	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:02	HHTHHQSVL	0.9993	0.9353	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:31	THHQSVLSI	0.9993	0.8029	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:02	THHQSVLSI	0.999	0.8239	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:05	THHQSVLSI	0.9986	0.886	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:05	HHTHHQSVL	0.9981	0.97	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:31	GHHTHHQSV	0.9967	0.9094	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:05	GHHTHHQSV	0.9954	0.9641	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	THHQSVLSI	0.9939	0.5473	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	HHTHHQSVL	0.9777	0.6896	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	GHHTHHQSV	0.9557	0.8502	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:11	THHQSVLSI	0.8414	0.7035	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:04	THHQSVLSI	0.7877	0.919	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:11	HHTHHQSVL	0.7728	0.8647	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:22	THHQSVLSI	0.7458	0.697	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:11	GHHTHHQSV	0.7127	0.7523	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:02	HHTHHQSVL	0.6801	0.9598	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C03:67	HHTHHQSVL	0.6659	0.9785	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:04	HHTHHQSVL	0.6126	0.9717	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C06:08	THHQSVLSI	0.5087	0.9891	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C07:04	GHHTHHQSV	0.4153	0.9607	5	14
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C06:06	THHQSVLSI	0.3353	0.9916	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C06:06	HHTHHQSVL	0.2442	0.991	6	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C06:02	THHQSVLSI	0.1762	0.9907	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-C06:17	THHQSVLSI	0.1762	0.9907	8	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B39:11	GHHTHHQSVL	0.8928	0.8898	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	GHHTHHQSVL	0.8781	0.7069	5	15
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	HTHHQSVLSI	0.3178	0.5682	7	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:05	HTHHQSVLSI	0.2722	0.8792	7	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B38:05	HHTHHQSVLSI	0.9979	0.9168	6	17
DCAF6-PBX1	chr1	167974031	chr1	164761730	1582	HLA-B15:09	SGHHTHHQSVL	0.6786	0.7613	4	15

Top

Potential FusionNeoAntigen Information of DCAF6-PBX1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of DCAF6-PBX1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3355	HHTHHQSVLSIRGA	DCAF6	PBX1	chr1	167974031	chr1	164761730	1582

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DCAF6-PBX1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3355	HHTHHQSVLSIRGA	-7.15543	-7.26883
HLA-B14:02	3BVN	3355	HHTHHQSVLSIRGA	-4.77435	-5.80965
HLA-B52:01	3W39	3355	HHTHHQSVLSIRGA	-6.80875	-6.92215
HLA-B52:01	3W39	3355	HHTHHQSVLSIRGA	-4.20386	-5.23916
HLA-A11:01	4UQ2	3355	HHTHHQSVLSIRGA	-7.5194	-8.5547
HLA-A11:01	4UQ2	3355	HHTHHQSVLSIRGA	-6.9601	-7.0735
HLA-A24:02	5HGA	3355	HHTHHQSVLSIRGA	-7.52403	-7.63743
HLA-A24:02	5HGA	3355	HHTHHQSVLSIRGA	-5.82433	-6.85963
HLA-B27:05	6PYJ	3355	HHTHHQSVLSIRGA	-3.28285	-4.31815
HLA-B44:05	3DX8	3355	HHTHHQSVLSIRGA	-5.91172	-6.94702
HLA-B44:05	3DX8	3355	HHTHHQSVLSIRGA	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of DCAF6-PBX1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DCAF6-PBX1	chr1	167974031	chr1	164761730	4	14	SGHHTHHQSV	CTGGACACCACACACATCATCAGTCTGTTT
DCAF6-PBX1	chr1	167974031	chr1	164761730	4	15	SGHHTHHQSVL	CTGGACACCACACACATCATCAGTCTGTTTTGA
DCAF6-PBX1	chr1	167974031	chr1	164761730	5	14	GHHTHHQSV	GACACCACACACATCATCAGTCTGTTT
DCAF6-PBX1	chr1	167974031	chr1	164761730	5	15	GHHTHHQSVL	GACACCACACACATCATCAGTCTGTTTTGA
DCAF6-PBX1	chr1	167974031	chr1	164761730	6	14	HHTHHQSV	ACCACACACATCATCAGTCTGTTT
DCAF6-PBX1	chr1	167974031	chr1	164761730	6	15	HHTHHQSVL	ACCACACACATCATCAGTCTGTTTTGA
DCAF6-PBX1	chr1	167974031	chr1	164761730	6	17	HHTHHQSVLSI	ACCACACACATCATCAGTCTGTTTTGAGTATCC
DCAF6-PBX1	chr1	167974031	chr1	164761730	7	15	HTHHQSVL	ACACACATCATCAGTCTGTTTTGA
DCAF6-PBX1	chr1	167974031	chr1	164761730	7	17	HTHHQSVLSI	ACACACATCATCAGTCTGTTTTGAGTATCC
DCAF6-PBX1	chr1	167974031	chr1	164761730	7	18	HTHHQSVLSIR	ACACACATCATCAGTCTGTTTTGAGTATCCGAG
DCAF6-PBX1	chr1	167974031	chr1	164761730	8	17	THHQSVLSI	CACATCATCAGTCTGTTTTGAGTATCC
DCAF6-PBX1	chr1	167974031	chr1	164761730	9	17	HHQSVLSI	ATCATCAGTCTGTTTTGAGTATCC
DCAF6-PBX1	chr1	167974031	chr1	164761730	9	20	HHQSVLSIRGA	ATCATCAGTCTGTTTTGAGTATCCGAGGAGCCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of DCAF6-PBX1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	DCAF6-PBX1	chr1	167974031	ENST00000312263	chr1	164761730	ENST00000367897	TCGA-24-2024

Top

Potential target of CAR-T therapy development for DCAF6-PBX1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DCAF6-PBX1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DCAF6-PBX1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	PBX1	C0006413	Burkitt Lymphoma	2	CTD_human;ORPHANET
Tgene	PBX1	C0343640	African Burkitt's lymphoma	2	CTD_human
Tgene	PBX1	C1968949	Cakut	2	GENOMICS_ENGLAND
Tgene	PBX1	C4721444	Burkitt Leukemia	2	CTD_human
Tgene	PBX1	C0013146	Drug abuse	1	CTD_human
Tgene	PBX1	C0013170	Drug habituation	1	CTD_human
Tgene	PBX1	C0013222	Drug Use Disorders	1	CTD_human
Tgene	PBX1	C0029231	Organic Mental Disorders, Substance-Induced	1	CTD_human
Tgene	PBX1	C0038580	Substance Dependence	1	CTD_human
Tgene	PBX1	C0038586	Substance Use Disorders	1	CTD_human
Tgene	PBX1	C0236969	Substance-Related Disorders	1	CTD_human
Tgene	PBX1	C0431692	Bilateral renal hypoplasia	1	ORPHANET
Tgene	PBX1	C0740858	Substance abuse problem	1	CTD_human
Tgene	PBX1	C1510472	Drug Dependence	1	CTD_human
Tgene	PBX1	C4316881	Prescription Drug Abuse	1	CTD_human
Tgene	PBX1	C4539968	CONGENITAL ANOMALIES OF KIDNEY AND URINARY TRACT SYNDROME WITH OR WITHOUT HEARING LOSS, ABNORMAL EARS, OR DEVELOPMENTAL DELAY	1	GENOMICS_ENGLAND

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)