|
Fusion Protein:DDX58-KDM4C |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: DDX58-KDM4C | FusionPDB ID: 22058 | FusionGDB2.0 ID: 22058 | Hgene | Tgene | Gene symbol | DDX58 | KDM4C | Gene ID | 23586 | 23081 |
Gene name | DExD/H-box helicase 58 | lysine demethylase 4C | |
Synonyms | RIG-I|RIG1|RIGI|RLR-1|SGMRT2 | GASC1|JHDM3C|JMJD2C|TDRD14C | |
Cytomap | 9p21.1 | 9p24.1 | |
Type of gene | protein-coding | protein-coding | |
Description | probable ATP-dependent RNA helicase DDX58DEAD (Asp-Glu-Ala-Asp) box polypeptide 58DEAD box protein 58DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptideRNA helicase RIG-Iretinoic acid-inducible gene 1 proteinretinoic acid-inducible gene I protein | lysine-specific demethylase 4CJmjC domain-containing histone demethylation protein 3Cgene amplified in squamous cell carcinoma 1 proteinjumonji domain-containing protein 2Clysine (K)-specific demethylase 4Ctudor domain containing 14C | |
Modification date | 20200329 | 20200329 | |
UniProtAcc | O95786 Main function of 5'-partner protein: FUNCTION: Innate immune receptor that senses cytoplasmic viral nucleic acids and activates a downstream signaling cascade leading to the production of type I interferons and proinflammatory cytokines. Forms a ribonucleoprotein complex with viral RNAs on which it homooligomerizes to form filaments. The homooligomerization allows the recruitment of RNF135 an E3 ubiquitin-protein ligase that activates and amplifies the RIG-I-mediated antiviral signaling in an RNA length-dependent manner through ubiquitination-dependent and -independent mechanisms (PubMed:28469175, PubMed:31006531). Upon activation, associates with mitochondria antiviral signaling protein (MAVS/IPS1) that activates the IKK-related kinases TBK1 and IKBKE which in turn phosphorylate the interferon regulatory factors IRF3 and IRF7, activating transcription of antiviral immunological genes including the IFN-alpha and IFN-beta interferons (PubMed:28469175, PubMed:31006531). Ligands include 5'-triphosphorylated ssRNAs and dsRNAs but also short dsRNAs (<1 kb in length). In addition to the 5'-triphosphate moiety, blunt-end base pairing at the 5'-end of the RNA is very essential. Overhangs at the non-triphosphorylated end of the dsRNA RNA have no major impact on its activity. A 3'overhang at the 5'triphosphate end decreases and any 5'overhang at the 5' triphosphate end abolishes its activity. Detects both positive and negative strand RNA viruses including members of the families Paramyxoviridae: Human respiratory syncytial virus and measles virus (MeV), Rhabdoviridae: vesicular stomatitis virus (VSV), Orthomyxoviridae: influenza A and B virus, Flaviviridae: Japanese encephalitis virus (JEV), hepatitis C virus (HCV), dengue virus (DENV) and west Nile virus (WNV). It also detects rotaviruses and reoviruses. Also involved in antiviral signaling in response to viruses containing a dsDNA genome such as Epstein-Barr virus (EBV). Detects dsRNA produced from non-self dsDNA by RNA polymerase III, such as Epstein-Barr virus-encoded RNAs (EBERs). May play important roles in granulocyte production and differentiation, bacterial phagocytosis and in the regulation of cell migration. {ECO:0000269|PubMed:15208624, ECO:0000269|PubMed:15708988, ECO:0000269|PubMed:16125763, ECO:0000269|PubMed:16127453, ECO:0000269|PubMed:16153868, ECO:0000269|PubMed:17190814, ECO:0000269|PubMed:18636086, ECO:0000269|PubMed:19122199, ECO:0000269|PubMed:19211564, ECO:0000269|PubMed:19576794, ECO:0000269|PubMed:19609254, ECO:0000269|PubMed:19631370, ECO:0000269|PubMed:21742966, ECO:0000269|PubMed:28469175, ECO:0000269|PubMed:29117565, ECO:0000269|PubMed:31006531}. | Q9H3R0 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-9' and 'Lys-36' residues of histone H3, thereby playing a central role in histone code. Does not demethylate histone H3 'Lys-4', H3 'Lys-27' nor H4 'Lys-20'. Demethylates trimethylated H3 'Lys-9' and H3 'Lys-36' residue, while it has no activity on mono- and dimethylated residues. Demethylation of Lys residue generates formaldehyde and succinate. {ECO:0000269|PubMed:16603238, ECO:0000269|PubMed:28262558}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000379868, ENST00000379882, ENST00000379883, ENST00000542096, ENST00000545044, | ENST00000401787, ENST00000428870, ENST00000489243, ENST00000536108, ENST00000381306, ENST00000381309, ENST00000442236, ENST00000535193, ENST00000543771, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 7 X 6=294 | 22 X 22 X 7=3388 |
# samples | 9 | 26 | |
** MAII score | log2(9/294*10)=-1.70781924850669 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(26/3388*10)=-3.70385034630374 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: DDX58 [Title/Abstract] AND KDM4C [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: DDX58 [Title/Abstract] AND KDM4C [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | DDX58(32491298)-KDM4C(7011697), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | DDX58-KDM4C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DDX58-KDM4C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DDX58-KDM4C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DDX58-KDM4C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DDX58-KDM4C seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. DDX58-KDM4C seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. DDX58-KDM4C seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. DDX58-KDM4C seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. DDX58-KDM4C seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | DDX58 | GO:0009597 | detection of virus | 17079289 |
Hgene | DDX58 | GO:0010628 | positive regulation of gene expression | 24409285 |
Hgene | DDX58 | GO:0030334 | regulation of cell migration | 19122199 |
Hgene | DDX58 | GO:0032725 | positive regulation of granulocyte macrophage colony-stimulating factor production | 24409285 |
Hgene | DDX58 | GO:0032727 | positive regulation of interferon-alpha production | 19576794 |
Hgene | DDX58 | GO:0032728 | positive regulation of interferon-beta production | 17079289 |
Hgene | DDX58 | GO:0032755 | positive regulation of interleukin-6 production | 24409285 |
Hgene | DDX58 | GO:0032757 | positive regulation of interleukin-8 production | 24409285 |
Hgene | DDX58 | GO:0039529 | RIG-I signaling pathway | 28469175 |
Hgene | DDX58 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 17079289 |
Hgene | DDX58 | GO:0051091 | positive regulation of DNA-binding transcription factor activity | 17079289 |
Hgene | DDX58 | GO:0051607 | defense response to virus | 21478870 |
Tgene | KDM4C | GO:0006357 | regulation of transcription by RNA polymerase II | 17277772 |
Tgene | KDM4C | GO:0033169 | histone H3-K9 demethylation | 18066052|21914792 |
Tgene | KDM4C | GO:0070544 | histone H3-K36 demethylation | 21914792 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:32491298/chr9:7011697) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across DDX58 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across KDM4C (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000379882 | DDX58 | chr9 | 32491298 | - | ENST00000535193 | KDM4C | chr9 | 7011697 | + | 2181 | 714 | 140 | 1369 | 409 |
ENST00000379882 | DDX58 | chr9 | 32491298 | - | ENST00000543771 | KDM4C | chr9 | 7011697 | + | 2181 | 714 | 140 | 1369 | 409 |
ENST00000379882 | DDX58 | chr9 | 32491298 | - | ENST00000381306 | KDM4C | chr9 | 7011697 | + | 2964 | 714 | 140 | 2071 | 643 |
ENST00000379882 | DDX58 | chr9 | 32491298 | - | ENST00000381309 | KDM4C | chr9 | 7011697 | + | 3018 | 714 | 140 | 2098 | 652 |
ENST00000379882 | DDX58 | chr9 | 32491298 | - | ENST00000442236 | KDM4C | chr9 | 7011697 | + | 2194 | 714 | 140 | 2098 | 652 |
ENST00000379868 | DDX58 | chr9 | 32491298 | - | ENST00000535193 | KDM4C | chr9 | 7011697 | + | 2052 | 585 | 503 | 1240 | 245 |
ENST00000379868 | DDX58 | chr9 | 32491298 | - | ENST00000543771 | KDM4C | chr9 | 7011697 | + | 2052 | 585 | 503 | 1240 | 245 |
ENST00000379868 | DDX58 | chr9 | 32491298 | - | ENST00000381306 | KDM4C | chr9 | 7011697 | + | 2835 | 585 | 503 | 1942 | 479 |
ENST00000379868 | DDX58 | chr9 | 32491298 | - | ENST00000381309 | KDM4C | chr9 | 7011697 | + | 2889 | 585 | 503 | 1969 | 488 |
ENST00000379868 | DDX58 | chr9 | 32491298 | - | ENST00000442236 | KDM4C | chr9 | 7011697 | + | 2065 | 585 | 503 | 1969 | 488 |
ENST00000379883 | DDX58 | chr9 | 32491298 | - | ENST00000535193 | KDM4C | chr9 | 7011697 | + | 2316 | 849 | 140 | 1504 | 454 |
ENST00000379883 | DDX58 | chr9 | 32491298 | - | ENST00000543771 | KDM4C | chr9 | 7011697 | + | 2316 | 849 | 140 | 1504 | 454 |
ENST00000379883 | DDX58 | chr9 | 32491298 | - | ENST00000381306 | KDM4C | chr9 | 7011697 | + | 3099 | 849 | 140 | 2206 | 688 |
ENST00000379883 | DDX58 | chr9 | 32491298 | - | ENST00000381309 | KDM4C | chr9 | 7011697 | + | 3153 | 849 | 140 | 2233 | 697 |
ENST00000379883 | DDX58 | chr9 | 32491298 | - | ENST00000442236 | KDM4C | chr9 | 7011697 | + | 2329 | 849 | 140 | 2233 | 697 |
ENST00000545044 | DDX58 | chr9 | 32491298 | - | ENST00000535193 | KDM4C | chr9 | 7011697 | + | 2039 | 572 | 490 | 1227 | 245 |
ENST00000545044 | DDX58 | chr9 | 32491298 | - | ENST00000543771 | KDM4C | chr9 | 7011697 | + | 2039 | 572 | 490 | 1227 | 245 |
ENST00000545044 | DDX58 | chr9 | 32491298 | - | ENST00000381306 | KDM4C | chr9 | 7011697 | + | 2822 | 572 | 490 | 1929 | 479 |
ENST00000545044 | DDX58 | chr9 | 32491298 | - | ENST00000381309 | KDM4C | chr9 | 7011697 | + | 2876 | 572 | 490 | 1956 | 488 |
ENST00000545044 | DDX58 | chr9 | 32491298 | - | ENST00000442236 | KDM4C | chr9 | 7011697 | + | 2052 | 572 | 490 | 1956 | 488 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000379882 | ENST00000535193 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000728893 | 0.9992711 |
ENST00000379882 | ENST00000543771 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000728893 | 0.9992711 |
ENST00000379882 | ENST00000381306 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000707539 | 0.9992925 |
ENST00000379882 | ENST00000381309 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000635852 | 0.9993642 |
ENST00000379882 | ENST00000442236 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.00201176 | 0.9979882 |
ENST00000379868 | ENST00000535193 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.002467773 | 0.99753225 |
ENST00000379868 | ENST00000543771 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.002467773 | 0.99753225 |
ENST00000379868 | ENST00000381306 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000440304 | 0.9995597 |
ENST00000379868 | ENST00000381309 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000427295 | 0.9995727 |
ENST00000379868 | ENST00000442236 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.001629433 | 0.9983706 |
ENST00000379883 | ENST00000535193 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000638131 | 0.99936193 |
ENST00000379883 | ENST00000543771 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000638131 | 0.99936193 |
ENST00000379883 | ENST00000381306 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000698357 | 0.9993017 |
ENST00000379883 | ENST00000381309 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000606096 | 0.99939394 |
ENST00000379883 | ENST00000442236 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.002155503 | 0.99784446 |
ENST00000545044 | ENST00000535193 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.002474541 | 0.9975255 |
ENST00000545044 | ENST00000543771 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.002474541 | 0.9975255 |
ENST00000545044 | ENST00000381306 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.000432125 | 0.9995679 |
ENST00000545044 | ENST00000381309 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.00041817 | 0.9995819 |
ENST00000545044 | ENST00000442236 | DDX58 | chr9 | 32491298 | - | KDM4C | chr9 | 7011697 | + | 0.00156753 | 0.99843246 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for DDX58-KDM4C |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
DDX58 | chr9 | 32491298 | KDM4C | chr9 | 7011697 | 572 | 25 | DPECQNLSENSCPPSELPEVLSIEEE |
DDX58 | chr9 | 32491298 | KDM4C | chr9 | 7011697 | 585 | 25 | DPECQNLSENSCPPSELPEVLSIEEE |
DDX58 | chr9 | 32491298 | KDM4C | chr9 | 7011697 | 714 | 189 | DPECQNLSENSCPPSELPEVLSIEEE |
DDX58 | chr9 | 32491298 | KDM4C | chr9 | 7011697 | 849 | 234 | DPECQNLSENSCPPSELPEVLSIEEE |
Top |
Potential FusionNeoAntigen Information of DDX58-KDM4C in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
DDX58-KDM4C_32491298_7011697.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:02 | CPPSELPEV | 0.9233 | 0.6385 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:01 | CPPSELPEV | 0.8698 | 0.6085 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:03 | PPSELPEVL | 0.7309 | 0.9319 | 12 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:02 | PPSELPEVL | 0.4462 | 0.979 | 12 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:04 | PPSELPEVL | 0.4462 | 0.979 | 12 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B44:03 | SENSCPPSEL | 0.9671 | 0.9614 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B47:01 | SENSCPPSEL | 0.9493 | 0.5574 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B39:13 | SENSCPPSEL | 0.8977 | 0.8516 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B45:01 | SENSCPPSEL | 0.8396 | 0.8394 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:03 | CPPSELPEVL | 0.8281 | 0.9478 | 11 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B41:01 | SENSCPPSEL | 0.5869 | 0.8684 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B45:01 | SENSCPPSELP | 0.9966 | 0.8007 | 7 | 18 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B41:01 | SENSCPPSELP | 0.9943 | 0.7961 | 7 | 18 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B50:02 | SENSCPPSELP | 0.9849 | 0.5857 | 7 | 18 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:03 | SCPPSELPEVL | 0.9778 | 0.9323 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B81:01 | SCPPSELPEVL | 0.9753 | 0.5102 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:04 | SCPPSELPEVL | 0.9515 | 0.981 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:02 | SCPPSELPEVL | 0.9515 | 0.981 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B82:01 | SCPPSELPEVL | 0.9022 | 0.5111 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B78:01 | CPPSELPEV | 0.9201 | 0.8089 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:08 | CPPSELPEV | 0.7428 | 0.6314 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:12 | PPSELPEVL | 0.4462 | 0.979 | 12 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B39:10 | PPSELPEVL | 0.0973 | 0.9535 | 12 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B39:08 | SENSCPPSEL | 0.9589 | 0.8463 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B07:12 | SCPPSELPEVL | 0.9597 | 0.573 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:12 | SCPPSELPEVL | 0.9515 | 0.981 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B39:10 | SCPPSELPEVL | 0.9482 | 0.9719 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B78:02 | CPPSELPEV | 0.9004 | 0.8743 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:09 | CPPSELPEV | 0.8729 | 0.6789 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:13 | CPPSELPEV | 0.8649 | 0.6075 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:14 | CPPSELPEV | 0.8553 | 0.6601 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:21 | CPPSELPEV | 0.8117 | 0.6634 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B59:01 | CPPSELPEV | 0.7387 | 0.7182 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:05 | CPPSELPEV | 0.705 | 0.6337 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B51:29 | CPPSELPEV | 0.5356 | 0.6288 | 11 | 20 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:09 | PPSELPEVL | 0.4462 | 0.979 | 12 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B67:01 | PPSELPEVL | 0.1017 | 0.7652 | 12 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B40:04 | SENSCPPSEL | 0.9964 | 0.7014 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B44:07 | SENSCPPSEL | 0.9671 | 0.9614 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B44:13 | SENSCPPSEL | 0.9671 | 0.9614 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B44:26 | SENSCPPSEL | 0.9671 | 0.9614 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B39:02 | SENSCPPSEL | 0.9066 | 0.8662 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B41:03 | SENSCPPSEL | 0.7563 | 0.5297 | 7 | 17 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:22 | SCPPSELPEVL | 0.9784 | 0.5363 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B35:09 | SCPPSELPEVL | 0.9515 | 0.981 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B55:04 | SCPPSELPEVL | 0.9511 | 0.6127 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B67:01 | SCPPSELPEVL | 0.9367 | 0.9535 | 10 | 21 |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 | HLA-B82:02 | SCPPSELPEVL | 0.9022 | 0.5111 | 10 | 21 |
Top |
Potential FusionNeoAntigen Information of DDX58-KDM4C in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of DDX58-KDM4C |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5616 | LSENSCPPSELPEV | DDX58 | KDM4C | chr9 | 32491298 | chr9 | 7011697 | 585 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DDX58-KDM4C |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5616 | LSENSCPPSELPEV | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 5616 | LSENSCPPSELPEV | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 5616 | LSENSCPPSELPEV | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 5616 | LSENSCPPSELPEV | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 5616 | LSENSCPPSELPEV | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 5616 | LSENSCPPSELPEV | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 5616 | LSENSCPPSELPEV | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 5616 | LSENSCPPSELPEV | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 5616 | LSENSCPPSELPEV | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 5616 | LSENSCPPSELPEV | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 5616 | LSENSCPPSELPEV | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of DDX58-KDM4C |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 10 | 21 | SCPPSELPEVL | CACCTTCAGAATTGCCTGAGGTTCTGTCCATTG |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 11 | 20 | CPPSELPEV | CTTCAGAATTGCCTGAGGTTCTGTCCA |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 11 | 21 | CPPSELPEVL | CTTCAGAATTGCCTGAGGTTCTGTCCATTG |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 12 | 21 | PPSELPEVL | CAGAATTGCCTGAGGTTCTGTCCATTG |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 7 | 17 | SENSCPPSEL | ATTCATGTCCACCTTCAGAATTGCCTGAGG |
DDX58-KDM4C | chr9 | 32491298 | chr9 | 7011697 | 7 | 18 | SENSCPPSELP | ATTCATGTCCACCTTCAGAATTGCCTGAGGTTC |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of DDX58-KDM4C |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Non-Cancer | DDX58-KDM4C | chr9 | 32491298 | ENST00000379868 | chr9 | 7011697 | ENST00000381306 | 5381N |
Top |
Potential target of CAR-T therapy development for DDX58-KDM4C |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to DDX58-KDM4C |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to DDX58-KDM4C |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |