|
|||||||
|
Fusion Protein:DHX9-VIM |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: DHX9-VIM | FusionPDB ID: 22734 | FusionGDB2.0 ID: 22734 | Hgene | Tgene | Gene symbol | DHX9 | VIM | Gene ID | 1660 | 7431 |
| Gene name | DExH-box helicase 9 | vimentin | |
| Synonyms | DDX9|LKP|NDH2|NDHII|RHA | - | |
| Cytomap | 1q25.3 | 10p13 | |
| Type of gene | protein-coding | protein-coding | |
| Description | ATP-dependent RNA helicase ADEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9DEAH (Asp-Glu-Ala-His) box helicase 9DEAH (Asp-Glu-Ala-His) box polypeptide 9DEAH box protein 9DEAH-box helicase 9RNA helicase Aleukophysinnuclear DNA helicase II | vimentinepididymis secretory sperm binding protein | |
| Modification date | 20200322 | 20200327 | |
| UniProtAcc | Q08211 Main function of 5'-partner protein: FUNCTION: Multifunctional ATP-dependent nucleic acid helicase that unwinds DNA and RNA in a 3' to 5' direction and that plays important roles in many processes, such as DNA replication, transcriptional activation, post-transcriptional RNA regulation, mRNA translation and RNA-mediated gene silencing (PubMed:9111062, PubMed:11416126, PubMed:12711669, PubMed:15355351, PubMed:16680162, PubMed:17531811, PubMed:20669935, PubMed:21561811, PubMed:24049074, PubMed:25062910, PubMed:24990949, PubMed:28221134). Requires a 3'-single-stranded tail as entry site for acid nuclei unwinding activities as well as the binding and hydrolyzing of any of the four ribo- or deoxyribo-nucleotide triphosphates (NTPs) (PubMed:1537828). Unwinds numerous nucleic acid substrates such as double-stranded (ds) DNA and RNA, DNA:RNA hybrids, DNA and RNA forks composed of either partially complementary DNA duplexes or DNA:RNA hybrids, respectively, and also DNA and RNA displacement loops (D- and R-loops), triplex-helical DNA (H-DNA) structure and DNA and RNA-based G-quadruplexes (PubMed:20669935, PubMed:21561811, PubMed:24049074). Binds dsDNA, single-stranded DNA (ssDNA), dsRNA, ssRNA and poly(A)-containing RNA (PubMed:9111062, PubMed:10198287). Binds also to circular dsDNA or dsRNA of either linear and/or circular forms and stimulates the relaxation of supercoiled DNAs catalyzed by topoisomerase TOP2A (PubMed:12711669). Plays a role in DNA replication at origins of replication and cell cycle progression (PubMed:24990949). Plays a role as a transcriptional coactivator acting as a bridging factor between polymerase II holoenzyme and transcription factors or cofactors, such as BRCA1, CREBBP, RELA and SMN1 (PubMed:11149922, PubMed:9323138, PubMed:9662397, PubMed:11038348, PubMed:11416126, PubMed:15355351, PubMed:28221134). Binds to the CDKN2A promoter (PubMed:11038348). Plays several roles in post-transcriptional regulation of gene expression (PubMed:28221134, PubMed:28355180). In cooperation with NUP98, promotes pre-mRNA alternative splicing activities of a subset of genes (PubMed:11402034, PubMed:16680162, PubMed:28221134, PubMed:28355180). As component of a large PER complex, is involved in the negative regulation of 3' transcriptional termination of circadian target genes such as PER1 and NR1D1 and the control of the circadian rhythms (By similarity). Acts also as a nuclear resolvase that is able to bind and neutralize harmful massive secondary double-stranded RNA structures formed by inverted-repeat Alu retrotransposon elements that are inserted and transcribed as parts of genes during the process of gene transposition (PubMed:28355180). Involved in the positive regulation of nuclear export of constitutive transport element (CTE)-containing unspliced mRNA (PubMed:9162007, PubMed:10924507, PubMed:11402034). Component of the coding region determinant (CRD)-mediated complex that promotes cytoplasmic MYC mRNA stability (PubMed:19029303). Plays a role in mRNA translation (PubMed:28355180). Positively regulates translation of selected mRNAs through its binding to post-transcriptional control element (PCE) in the 5'-untranslated region (UTR) (PubMed:16680162). Involved with LARP6 in the translation stimulation of type I collagen mRNAs for CO1A1 and CO1A2 through binding of a specific stem-loop structure in their 5'-UTRs (PubMed:22190748). Stimulates LIN28A-dependent mRNA translation probably by facilitating ribonucleoprotein remodeling during the process of translation (PubMed:21247876). Plays also a role as a small interfering (siRNA)-loading factor involved in the RNA-induced silencing complex (RISC) loading complex (RLC) assembly, and hence functions in the RISC-mediated gene silencing process (PubMed:17531811). Binds preferentially to short double-stranded RNA, such as those produced during rotavirus intestinal infection (PubMed:28636595). This interaction may mediate NLRP9 inflammasome activation and trigger inflammatory response, including IL18 release and pyroptosis (PubMed:28636595). Finally, mediates the attachment of heterogeneous nuclear ribonucleoproteins (hnRNPs) to actin filaments in the nucleus (PubMed:11687588). {ECO:0000250|UniProtKB:O70133, ECO:0000269|PubMed:10198287, ECO:0000269|PubMed:10924507, ECO:0000269|PubMed:11038348, ECO:0000269|PubMed:11149922, ECO:0000269|PubMed:11402034, ECO:0000269|PubMed:11416126, ECO:0000269|PubMed:11687588, ECO:0000269|PubMed:12711669, ECO:0000269|PubMed:15355351, ECO:0000269|PubMed:1537828, ECO:0000269|PubMed:16680162, ECO:0000269|PubMed:17531811, ECO:0000269|PubMed:19029303, ECO:0000269|PubMed:20669935, ECO:0000269|PubMed:21247876, ECO:0000269|PubMed:21561811, ECO:0000269|PubMed:22190748, ECO:0000269|PubMed:24049074, ECO:0000269|PubMed:24990949, ECO:0000269|PubMed:25062910, ECO:0000269|PubMed:28221134, ECO:0000269|PubMed:28355180, ECO:0000269|PubMed:28636595, ECO:0000269|PubMed:9111062, ECO:0000269|PubMed:9162007, ECO:0000269|PubMed:9323138, ECO:0000269|PubMed:9662397}.; FUNCTION: (Microbial infection) Plays a role in HIV-1 replication and virion infectivity (PubMed:11096080, PubMed:19229320, PubMed:25149208, PubMed:27107641). Enhances HIV-1 transcription by facilitating the binding of RNA polymerase II holoenzyme to the proviral DNA (PubMed:11096080, PubMed:25149208). Binds (via DRBM domain 2) to the HIV-1 TAR RNA and stimulates HIV-1 transcription of transactivation response element (TAR)-containing mRNAs (PubMed:9892698, PubMed:11096080). Involved also in HIV-1 mRNA splicing and transport (PubMed:25149208). Positively regulates HIV-1 gag mRNA translation, through its binding to post-transcriptional control element (PCE) in the 5'-untranslated region (UTR) (PubMed:16680162). Binds (via DRBM domains) to a HIV-1 double-stranded RNA region of the primer binding site (PBS)-segment of the 5'-UTR, and hence stimulates DHX9 incorporation into virions and virion infectivity (PubMed:27107641). Plays also a role as a cytosolic viral MyD88-dependent DNA and RNA sensors in plasmacytoid dendritic cells (pDCs), and hence induce antiviral innate immune responses (PubMed:20696886, PubMed:21957149). Binds (via the OB-fold region) to viral single-stranded DNA unmethylated C-phosphate-G (CpG) oligonucleotide (PubMed:20696886). {ECO:0000269|PubMed:11096080, ECO:0000269|PubMed:16680162, ECO:0000269|PubMed:19229320, ECO:0000269|PubMed:20696886, ECO:0000269|PubMed:21957149, ECO:0000269|PubMed:25149208, ECO:0000269|PubMed:27107641, ECO:0000269|PubMed:9892698}. | VMAC Main function of 5'-partner protein: 169 | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000367549, ENST00000485081, | ENST00000485947, ENST00000224237, ENST00000544301, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 14 X 10 X 7=980 | 42 X 25 X 11=11550 |
| # samples | 15 | 41 | |
| ** MAII score | log2(15/980*10)=-2.70781924850669 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(41/11550*10)=-4.81612513168534 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: DHX9 [Title/Abstract] AND VIM [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: DHX9 [Title/Abstract] AND VIM [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | DHX9(182821479)-VIM(17278292), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | DHX9-VIM seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DHX9-VIM seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DHX9-VIM seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DHX9-VIM seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | DHX9 | GO:0010501 | RNA secondary structure unwinding | 1537828|9111062 |
| Hgene | DHX9 | GO:0032508 | DNA duplex unwinding | 9111062|21561811 |
| Hgene | DHX9 | GO:0034622 | cellular protein-containing complex assembly | 23361462 |
| Hgene | DHX9 | GO:0039695 | DNA-templated viral transcription | 11096080 |
| Hgene | DHX9 | GO:0044806 | G-quadruplex DNA unwinding | 21561811 |
| Hgene | DHX9 | GO:0046833 | positive regulation of RNA export from nucleus | 11402034 |
| Hgene | DHX9 | GO:0050434 | positive regulation of viral transcription | 11096080 |
| Hgene | DHX9 | GO:0050684 | regulation of mRNA processing | 28355180 |
| Hgene | DHX9 | GO:2000765 | regulation of cytoplasmic translation | 28355180 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:182821479/chr10:17278292) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across DHX9 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across VIM (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000367549 | DHX9 | chr1 | 182821479 | + | ENST00000544301 | VIM | chr10 | 17278292 | + | 916 | 474 | 110 | 601 | 163 |
| ENST00000367549 | DHX9 | chr1 | 182821479 | + | ENST00000224237 | VIM | chr10 | 17278292 | + | 924 | 474 | 110 | 601 | 163 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000367549 | ENST00000544301 | DHX9 | chr1 | 182821479 | + | VIM | chr10 | 17278292 | + | 0.002458611 | 0.9975414 |
| ENST00000367549 | ENST00000224237 | DHX9 | chr1 | 182821479 | + | VIM | chr10 | 17278292 | + | 0.002782123 | 0.9972179 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for DHX9-VIM |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| DHX9 | chr1 | 182821479 | VIM | chr10 | 17278292 | 474 | 121 | MGGPLPPHLALKAETNLDSLPLVDTH |
Top |
Potential FusionNeoAntigen Information of DHX9-VIM in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| DHX9-VIM_182821479_17278292.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B39:13 | AETNLDSL | 0.8697 | 0.9108 | 12 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B45:01 | AETNLDSLP | 0.9689 | 0.8613 | 12 | 21 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B50:02 | AETNLDSLP | 0.9278 | 0.5866 | 12 | 21 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B41:01 | AETNLDSLP | 0.2625 | 0.8986 | 12 | 21 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B50:01 | AETNLDSLP | 0.0553 | 0.5963 | 12 | 21 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B39:08 | AETNLDSL | 0.9514 | 0.7658 | 12 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:19 | LALKAETNL | 0.9996 | 0.9918 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C05:09 | KAETNLDSL | 0.9996 | 0.8763 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:07 | LALKAETNL | 0.9995 | 0.9899 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:08 | LALKAETNL | 0.9994 | 0.8955 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C08:15 | KAETNLDSL | 0.9993 | 0.9531 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C08:04 | KAETNLDSL | 0.803 | 0.9267 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C08:13 | KAETNLDSL | 0.803 | 0.9267 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C08:03 | KAETNLDSL | 0.5737 | 0.978 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B40:04 | AETNLDSL | 0.9997 | 0.6428 | 12 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B41:03 | AETNLDSL | 0.876 | 0.5027 | 12 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C05:01 | KAETNLDSL | 0.9996 | 0.8763 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:04 | LALKAETNL | 0.9996 | 0.9889 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:03 | LALKAETNL | 0.9996 | 0.9889 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:05 | LALKAETNL | 0.9995 | 0.9309 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:17 | LALKAETNL | 0.9993 | 0.9659 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C08:02 | KAETNLDSL | 0.9993 | 0.9531 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:06 | LALKAETNL | 0.9805 | 0.9906 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B35:13 | LALKAETNL | 0.8096 | 0.9298 | 8 | 17 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C03:06 | KAETNLDSL | 0.7171 | 0.9885 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-C08:01 | KAETNLDSL | 0.5737 | 0.978 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B35:13 | KAETNLDSL | 0.1971 | 0.9012 | 11 | 20 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B50:05 | AETNLDSLP | 0.0553 | 0.5963 | 12 | 21 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B50:04 | AETNLDSLP | 0.0553 | 0.5963 | 12 | 21 |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 474 | HLA-B07:13 | KAETNLDSL | 0.0167 | 0.778 | 11 | 20 |
Top |
Potential FusionNeoAntigen Information of DHX9-VIM in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of DHX9-VIM |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 6687 | PHLALKAETNLDSL | DHX9 | VIM | chr1 | 182821479 | chr10 | 17278292 | 474 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DHX9-VIM |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 6687 | PHLALKAETNLDSL | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 6687 | PHLALKAETNLDSL | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 6687 | PHLALKAETNLDSL | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 6687 | PHLALKAETNLDSL | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 6687 | PHLALKAETNLDSL | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 6687 | PHLALKAETNLDSL | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 6687 | PHLALKAETNLDSL | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 6687 | PHLALKAETNLDSL | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 6687 | PHLALKAETNLDSL | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 6687 | PHLALKAETNLDSL | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 6687 | PHLALKAETNLDSL | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of DHX9-VIM |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 11 | 20 | KAETNLDSL | AAGCAGAAACTAATCTGGATTCACTCC |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 12 | 20 | AETNLDSL | CAGAAACTAATCTGGATTCACTCC |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 12 | 21 | AETNLDSLP | CAGAAACTAATCTGGATTCACTCCCTC |
| DHX9-VIM | chr1 | 182821479 | chr10 | 17278292 | 8 | 17 | LALKAETNL | TGGCTCTCAAAGCAGAAACTAATCTGG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of DHX9-VIM |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | DHX9-VIM | chr1 | 182821479 | ENST00000367549 | chr10 | 17278292 | ENST00000224237 | TCGA-HU-A4GQ |
Top |
Potential target of CAR-T therapy development for DHX9-VIM |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to DHX9-VIM |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to DHX9-VIM |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies