Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DMD-LIX1L

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DMD-LIX1L
	FusionPDB ID: 23229
	FusionGDB2.0 ID: 23229
		Hgene	Tgene
	Gene symbol	DMD	LIX1L
	Gene ID	1756	128077
	Gene name	dystrophin	limb and CNS expressed 1 like
	Synonyms	BMD\|CMD3B\|DXS142\|DXS164\|DXS206\|DXS230\|DXS239\|DXS268\|DXS269\|DXS270\|DXS272\|MRX85	-
	Cytomap	Xp21.2-p21.1	1q21.1
	Type of gene	protein-coding	protein-coding
	Description	dystrophin	LIX1-like proteinLix1 homolog-like
	Modification date	20200329	20200313
	UniProtAcc	P11532 Main function of 5'-partner protein: FUNCTION: Anchors the extracellular matrix to the cytoskeleton via F-actin. Ligand for dystroglycan. Component of the dystrophin-associated glycoprotein complex which accumulates at the neuromuscular junction (NMJ) and at a variety of synapses in the peripheral and central nervous systems and has a structural function in stabilizing the sarcolemma. Also implicated in signaling events and synaptic transmission. {ECO:0000250\|UniProtKB:P11531, ECO:0000269\|PubMed:16710609}.	Q8IVB5 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000343523, ENST00000357033, ENST00000359836, ENST00000361471, ENST00000378677, ENST00000378680, ENST00000378702, ENST00000378707, ENST00000378723, ENST00000474231, ENST00000541735, ENST00000288447, ENST00000445312,	ENST00000369308,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	32 X 35 X 5=5600	4 X 4 X 4=64
	# samples	36	6
	** MAII score	log2(36/5600*10)=-3.95935801550265 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/64*10)=-0.0931094043914815 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: DMD [Title/Abstract] AND LIX1L [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DMD [Title/Abstract] AND LIX1L [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DMD(31279072)-LIX1L(145487304), # samples:3
Anticipated loss of major functional domain due to fusion event.	DMD-LIX1L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DMD-LIX1L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	DMD	GO:0043043	peptide biosynthetic process	16000376

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:31279072/chr1:145487304)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DMD (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LIX1L (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000378707	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	6560	2947	144	3668	1174
ENST00000359836	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	6560	2947	144	3668	1174
ENST00000541735	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	6560	2947	144	3668	1174
ENST00000343523	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	6560	2947	144	3668	1174
ENST00000378677	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	13082	9469	195	10190	3331
ENST00000357033	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	13106	9493	207	10214	3335
ENST00000474231	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	6560	2947	144	3668	1174
ENST00000378723	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	3818	205	123	926	267
ENST00000378702	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	3723	110	28	831	267
ENST00000361471	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	3773	160	78	881	267
ENST00000378680	DMD	chrX	31279072	-	ENST00000369308	LIX1L	chr1	145487304	-	3815	202	120	923	267
ENST00000378707	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	6560	2947	144	3668	1174
ENST00000359836	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	6560	2947	144	3668	1174
ENST00000541735	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	6560	2947	144	3668	1174
ENST00000343523	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	6560	2947	144	3668	1174
ENST00000378677	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	13082	9469	195	10190	3331
ENST00000357033	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	13106	9493	207	10214	3335
ENST00000474231	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	6560	2947	144	3668	1174
ENST00000378723	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	3818	205	123	926	267
ENST00000378702	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	3723	110	28	831	267
ENST00000361471	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	3773	160	78	881	267
ENST00000378680	DMD	chrX	31279071	-	ENST00000369308	LIX1L	chr1	145487303	+	3815	202	120	923	267

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000378707	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.000853709	0.9991462
ENST00000359836	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.000853709	0.9991462
ENST00000541735	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.000853709	0.9991462
ENST00000343523	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.000853709	0.9991462
ENST00000378677	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.001219091	0.9987809
ENST00000357033	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.001242716	0.99875724
ENST00000474231	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.000853709	0.9991462
ENST00000378723	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.00186165	0.9981383
ENST00000378702	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.001734604	0.99826545
ENST00000361471	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.001794835	0.9982052
ENST00000378680	ENST00000369308	DMD	chrX	31279072	-	LIX1L	chr1	145487304	-	0.001855925	0.99814403
ENST00000378707	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.000853709	0.9991462
ENST00000359836	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.000853709	0.9991462
ENST00000541735	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.000853709	0.9991462
ENST00000343523	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.000853709	0.9991462
ENST00000378677	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.001219091	0.9987809
ENST00000357033	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.001242716	0.99875724
ENST00000474231	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.000853709	0.9991462
ENST00000378723	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.00186165	0.9981383
ENST00000378702	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.001734604	0.99826545
ENST00000361471	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.001794835	0.9982052
ENST00000378680	ENST00000369308	DMD	chrX	31279071	-	LIX1L	chr1	145487303	+	0.001855925	0.99814403

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DMD-LIX1L

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DMD	chrX	31279071	LIX1L	chr1	145487303	110	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279071	LIX1L	chr1	145487303	160	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279071	LIX1L	chr1	145487303	202	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279071	LIX1L	chr1	145487303	205	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279071	LIX1L	chr1	145487303	2947	934	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279071	LIX1L	chr1	145487303	9469	3091	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279071	LIX1L	chr1	145487303	9493	3095	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279072	LIX1L	chr1	145487304	110	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279072	LIX1L	chr1	145487304	160	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279072	LIX1L	chr1	145487304	202	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279072	LIX1L	chr1	145487304	205	27	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279072	LIX1L	chr1	145487304	2947	934	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279072	LIX1L	chr1	145487304	9469	3091	WDHPKMTELYQSLVNVVEALQEFWQM
DMD	chrX	31279072	LIX1L	chr1	145487304	9493	3095	WDHPKMTELYQSLVNVVEALQEFWQM

Top

Potential FusionNeoAntigen Information of DMD-LIX1L in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DMD-LIX1L_31279071_145487303.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B13:02	YQSLVNVV	0.9949	0.8489	9	17
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B52:01	YQSLVNVV	0.899	0.9893	9	17
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:22	ELYQSLVNV	0.9959	0.6364	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:22	SLVNVVEAL	0.9949	0.5209	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:27	SLVNVVEAL	0.9899	0.6695	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:13	ELYQSLVNV	0.9886	0.7512	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:13	SLVNVVEAL	0.9881	0.7831	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:27	ELYQSLVNV	0.9875	0.6718	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:35	ELYQSLVNV	0.9846	0.6026	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:24	SLVNVVEAL	0.9832	0.7192	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:30	SLVNVVEAL	0.9832	0.7192	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:67	SLVNVVEAL	0.9832	0.7192	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:11	SLVNVVEAL	0.9828	0.7525	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:60	SLVNVVEAL	0.9823	0.6791	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:16	SLVNVVEAL	0.9816	0.5845	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:38	ELYQSLVNV	0.9814	0.7186	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:16	ELYQSLVNV	0.9789	0.6174	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:29	ELYQSLVNV	0.977	0.5929	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:20	ELYQSLVNV	0.9768	0.597	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:21	SLVNVVEAL	0.9756	0.8274	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:11	ELYQSLVNV	0.9751	0.6377	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:21	ELYQSLVNV	0.9739	0.7092	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:67	ELYQSLVNV	0.9734	0.5905	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:30	ELYQSLVNV	0.9734	0.5905	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:24	ELYQSLVNV	0.9734	0.5905	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:60	ELYQSLVNV	0.9731	0.5807	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:35	SLVNVVEAL	0.971	0.7418	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:38	SLVNVVEAL	0.9707	0.6839	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:29	SLVNVVEAL	0.9701	0.7135	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:04	SLVNVVEAL	0.9673	0.6206	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:19	ELYQSLVNV	0.9497	0.5333	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:20	SLVNVVEAL	0.948	0.7246	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:19	SLVNVVEAL	0.9308	0.522	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:04	ELYQSLVNV	0.9111	0.7121	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B13:02	ELYQSLVNV	0.2841	0.5474	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B13:01	SLVNVVEAL	0.0803	0.9065	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:24	TELYQSLVNV	0.8716	0.6338	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:67	TELYQSLVNV	0.8716	0.6338	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:30	TELYQSLVNV	0.8716	0.6338	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:29	TELYQSLVNV	0.8347	0.6392	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:11	TELYQSLVNV	0.8297	0.6769	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:20	TELYQSLVNV	0.8104	0.6427	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:35	TELYQSLVNV	0.7734	0.6609	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:16	TELYQSLVNV	0.7422	0.5821	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:13	TELYQSLVNV	0.5797	0.7627	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B51:07	YQSLVNVV	0.8974	0.9772	9	17
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:05	ELYQSLVNV	0.9954	0.5849	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:07	SLVNVVEAL	0.9835	0.7285	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:01	SLVNVVEAL	0.9832	0.7192	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:07	ELYQSLVNV	0.974	0.6062	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:01	ELYQSLVNV	0.9734	0.5905	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B51:07	ELYQSLVNV	0.2049	0.9445	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:01	TELYQSLVNV	0.8716	0.6338	6	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:03	ELYQSLVNV	0.9962	0.6878	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:03	SLVNVVEAL	0.9946	0.7662	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A68:02	ELYQSLVNV	0.9945	0.7745	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A69:01	ELYQSLVNV	0.9897	0.6979	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:14	SLVNVVEAL	0.9762	0.7595	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:06	SLVNVVEAL	0.9756	0.8274	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:14	ELYQSLVNV	0.974	0.6682	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:06	ELYQSLVNV	0.9739	0.7092	7	16
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B15:73	SLVNVVEAL	0.9328	0.9299	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-B15:30	SLVNVVEAL	0.8695	0.7743	11	20
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-C14:03	LYQSLVNVV	0.0963	0.9735	8	17
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-C14:02	LYQSLVNVV	0.0963	0.9735	8	17
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	HLA-A02:03	TELYQSLVNV	0.7237	0.733	6	16

Top

Potential FusionNeoAntigen Information of DMD-LIX1L in HLA II

DMD-LIX1L_31279071_145487303.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0405	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0424	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0429	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0430	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0445	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0448	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0457	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0477	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0483	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0484	TELYQSLVNVVEALQ	6	21
DMD-LIX1L	chrX	31279071	chr1	145487303	2947	DRB1-0489	TELYQSLVNVVEALQ	6	21

Top

Fusion breakpoint peptide structures of DMD-LIX1L

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9308	TELYQSLVNVVEAL	DMD	LIX1L	chrX	31279071	chr1	145487303	2947

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DMD-LIX1L

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9308	TELYQSLVNVVEAL	-7.9962	-8.1096
HLA-B14:02	3BVN	9308	TELYQSLVNVVEAL	-5.70842	-6.74372
HLA-B52:01	3W39	9308	TELYQSLVNVVEAL	-6.83737	-6.95077
HLA-B52:01	3W39	9308	TELYQSLVNVVEAL	-4.4836	-5.5189
HLA-A11:01	4UQ2	9308	TELYQSLVNVVEAL	-10.0067	-10.1201
HLA-A11:01	4UQ2	9308	TELYQSLVNVVEAL	-9.03915	-10.0745
HLA-A24:02	5HGA	9308	TELYQSLVNVVEAL	-6.56204	-6.67544
HLA-A24:02	5HGA	9308	TELYQSLVNVVEAL	-5.42271	-6.45801
HLA-B44:05	3DX8	9308	TELYQSLVNVVEAL	-7.85648	-8.89178
HLA-B44:05	3DX8	9308	TELYQSLVNVVEAL	-5.3978	-5.5112
HLA-A02:01	6TDR	9308	TELYQSLVNVVEAL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of DMD-LIX1L

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DMD-LIX1L	chrX	31279071	chr1	145487303	11	20	SLVNVVEAL	CTTTAGTGAATGTGGTGGAGGCACTTC
DMD-LIX1L	chrX	31279071	chr1	145487303	6	16	TELYQSLVNV	CAGAGCTCTACCAGTCTTTAGTGAATGTGG
DMD-LIX1L	chrX	31279071	chr1	145487303	7	16	ELYQSLVNV	AGCTCTACCAGTCTTTAGTGAATGTGG
DMD-LIX1L	chrX	31279071	chr1	145487303	8	17	LYQSLVNVV	TCTACCAGTCTTTAGTGAATGTGGTGG
DMD-LIX1L	chrX	31279071	chr1	145487303	9	17	YQSLVNVV	ACCAGTCTTTAGTGAATGTGGTGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
DMD-LIX1L	chrX	31279071	chr1	145487303	6	21	TELYQSLVNVVEALQ	CAGAGCTCTACCAGTCTTTAGTGAATGTGGTGGAGGCACTTCAGG

Top

Information of the samples that have these potential fusion neoantigens of DMD-LIX1L

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	DMD-LIX1L	chrX	31279071	ENST00000343523	chr1	145487303	ENST00000369308	TCGA-DX-A1KY

Top

Potential target of CAR-T therapy development for DMD-LIX1L

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DMD-LIX1L

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DMD-LIX1L

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)