![]() |
|||||||
|
Fusion Protein:DNAJB12-NEK5 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: DNAJB12-NEK5 | FusionPDB ID: 23407 | FusionGDB2.0 ID: 23407 | Hgene | Tgene | Gene symbol | DNAJB12 | NEK5 | Gene ID | 54788 | 341676 |
Gene name | DnaJ heat shock protein family (Hsp40) member B12 | NIMA related kinase 5 | |
Synonyms | DJ10 | - | |
Cytomap | 10q22.1 | 13q14.3 | |
Type of gene | protein-coding | protein-coding | |
Description | dnaJ homolog subfamily B member 12DnaJ (Hsp40) homolog, subfamily B, member 12 | serine/threonine-protein kinase Nek5NIMA (never in mitosis gene a)-related kinase 5nimA-related protein kinase 5 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q9NXW2 Main function of 5'-partner protein: FUNCTION: Acts as a co-chaperone with HSPA8/Hsc70; required to promote protein folding and trafficking, prevent aggregation of client proteins, and promote unfolded proteins to endoplasmic reticulum-associated degradation (ERAD) pathway (PubMed:21150129, PubMed:21148293). Acts by determining HSPA8/Hsc70's ATPase and polypeptide-binding activities. Can also act independently of HSPA8/Hsc70: together with DNAJB14, acts as a chaperone that promotes maturation of potassium channels KCND2 and KCNH2 by stabilizing nascent channel subunits and assembling them into tetramers (PubMed:27916661). While stabilization of nascent channel proteins is dependent on HSPA8/Hsc70, the process of oligomerization of channel subunits is independent of HSPA8/Hsc70 (PubMed:27916661). When overexpressed, forms membranous structures together with DNAJB14 and HSPA8/Hsc70 within the nucleus; the role of these structures, named DJANGOs, is still unclear (PubMed:24732912). {ECO:0000269|PubMed:21148293, ECO:0000269|PubMed:21150129, ECO:0000269|PubMed:24732912, ECO:0000269|PubMed:27916661}.; FUNCTION: (Microbial infection) In case of infection by polyomavirus, involved in the virus endoplasmic reticulum membrane penetration and infection (PubMed:21673190, PubMed:24675744). {ECO:0000269|PubMed:21673190, ECO:0000269|PubMed:24675744}. | Q6P3R8 Main function of 5'-partner protein: | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000338820, ENST00000394903, ENST00000444643, ENST00000461919, | ENST00000529080, ENST00000355568, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 3 X 2 X 2=12 | 3 X 3 X 3=27 |
# samples | 4 | 3 | |
** MAII score | log2(4/12*10)=1.73696559416621 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: DNAJB12 [Title/Abstract] AND NEK5 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: DNAJB12 [Title/Abstract] AND NEK5 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | DNAJB12(74114523)-NEK5(52650279), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | DNAJB12-NEK5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNAJB12-NEK5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | DNAJB12 | GO:0034622 | cellular protein-containing complex assembly | 27916661 |
Hgene | DNAJB12 | GO:0036503 | ERAD pathway | 21148293|21150129 |
Hgene | DNAJB12 | GO:0051085 | chaperone cofactor-dependent protein refolding | 27916661 |
Hgene | DNAJB12 | GO:0071218 | cellular response to misfolded protein | 21148293|21150129 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:74114523/chr13:52650279) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000394903 | DNAJB12 | chr10 | 74114523 | - | ENST00000355568 | NEK5 | chr13 | 52650279 | - | 1516 | 385 | 241 | 864 | 207 |
ENST00000338820 | DNAJB12 | chr10 | 74114523 | - | ENST00000355568 | NEK5 | chr13 | 52650279 | - | 1516 | 385 | 241 | 864 | 207 |
ENST00000444643 | DNAJB12 | chr10 | 74114523 | - | ENST00000355568 | NEK5 | chr13 | 52650279 | - | 1597 | 466 | 322 | 945 | 207 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000394903 | ENST00000355568 | DNAJB12 | chr10 | 74114523 | - | NEK5 | chr13 | 52650279 | - | 0.001476182 | 0.9985239 |
ENST00000338820 | ENST00000355568 | DNAJB12 | chr10 | 74114523 | - | NEK5 | chr13 | 52650279 | - | 0.001476182 | 0.9985239 |
ENST00000444643 | ENST00000355568 | DNAJB12 | chr10 | 74114523 | - | NEK5 | chr13 | 52650279 | - | 0.00126943 | 0.9987306 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for DNAJB12-NEK5 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
DNAJB12 | chr10 | 74114523 | NEK5 | chr13 | 52650279 | 385 | 46 | SWRRHSGCIRRREFADIEKDLKQMRL |
DNAJB12 | chr10 | 74114523 | NEK5 | chr13 | 52650279 | 466 | 46 | SWRRHSGCIRRREFADIEKDLKQMRL |
Top |
Potential FusionNeoAntigen Information of DNAJB12-NEK5 in HLA I |
![]() |
DNAJB12-NEK5_74114523_52650279.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B27:05 | RRREFADIEK | 0.999 | 0.8222 | 9 | 19 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B13:01 | REFADIEKDL | 0.9795 | 0.9555 | 11 | 21 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B47:01 | REFADIEKDL | 0.9774 | 0.5583 | 11 | 21 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B39:13 | REFADIEKDL | 0.8551 | 0.9009 | 11 | 21 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B27:14 | RREFADIEK | 0.9503 | 0.8087 | 10 | 19 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B27:14 | RRREFADIEK | 0.9987 | 0.7608 | 9 | 19 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B40:06 | REFADIEKDL | 0.9967 | 0.6884 | 11 | 21 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B27:03 | RRREFADIEK | 0.9842 | 0.8325 | 9 | 19 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B39:08 | REFADIEKDL | 0.947 | 0.8588 | 11 | 21 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B27:10 | RRREFADIEK | 0.9984 | 0.9063 | 9 | 19 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B40:04 | REFADIEKDL | 0.9923 | 0.7605 | 11 | 21 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | HLA-B41:03 | REFADIEKDL | 0.7921 | 0.5568 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of DNAJB12-NEK5 in HLA II |
![]() |
DNAJB12-NEK5_74114523_52650279.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0301 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0303 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0307 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0313 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0315 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0318 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0320 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0322 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0328 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0330 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0332 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0334 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0336 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0344 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0346 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0348 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0350 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0352 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-0354 | REFADIEKDLKQMRL | 11 | 26 |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 | DRB1-1107 | REFADIEKDLKQMRL | 11 | 26 |
Top |
Fusion breakpoint peptide structures of DNAJB12-NEK5 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2690 | GCIRRREFADIEKD | DNAJB12 | NEK5 | chr10 | 74114523 | chr13 | 52650279 | 385 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DNAJB12-NEK5 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2690 | GCIRRREFADIEKD | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 2690 | GCIRRREFADIEKD | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 2690 | GCIRRREFADIEKD | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 2690 | GCIRRREFADIEKD | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 2690 | GCIRRREFADIEKD | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 2690 | GCIRRREFADIEKD | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 2690 | GCIRRREFADIEKD | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 2690 | GCIRRREFADIEKD | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 2690 | GCIRRREFADIEKD | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 2690 | GCIRRREFADIEKD | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 2690 | GCIRRREFADIEKD | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of DNAJB12-NEK5 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 10 | 19 | RREFADIEK | GAGTTCGCGGACATTGAAAAAGACTTG |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 11 | 21 | REFADIEKDL | TTCGCGGACATTGAAAAAGACTTGAAACAA |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 9 | 19 | RRREFADIEK | CGCGAGTTCGCGGACATTGAAAAAGACTTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
DNAJB12-NEK5 | chr10 | 74114523 | chr13 | 52650279 | 11 | 26 | REFADIEKDLKQMRL | TTCGCGGACATTGAAAAAGACTTGAAACAAATGAGGCTTCAGAAC |
Top |
Information of the samples that have these potential fusion neoantigens of DNAJB12-NEK5 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | DNAJB12-NEK5 | chr10 | 74114523 | ENST00000338820 | chr13 | 52650279 | ENST00000355568 | TCGA-BR-8284-01A |
Top |
Potential target of CAR-T therapy development for DNAJB12-NEK5 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to DNAJB12-NEK5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to DNAJB12-NEK5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |