Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DNALI1-ARHGEF6

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DNALI1-ARHGEF6
	FusionPDB ID: 23598
	FusionGDB2.0 ID: 23598
		Hgene	Tgene
	Gene symbol	DNALI1	ARHGEF6
	Gene ID	7802	9459
	Gene name	dynein axonemal light intermediate chain 1	Rac/Cdc42 guanine nucleotide exchange factor 6
	Synonyms	P28\|dJ423B22.5\|hp28	COOL2\|Cool-2\|MRX46\|PIXA\|alpha-PIX\|alphaPIX
	Cytomap	1p34.3	Xq26.3
	Type of gene	protein-coding	protein-coding
	Description	axonemal dynein light intermediate polypeptide 1dJ423B22.5 (axonemal dynein light chain (hp28))dynein, axonemal, light intermediate polypeptide 1inner dynein arm light chain, axonemalinner dynein arm, homolog of clamydomonas	rho guanine nucleotide exchange factor 6PAK-interacting exchange factor, alphaRac/Cdc42 guanine exchange factor (GEF) 6Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
	Modification date	20200327	20200327
	UniProtAcc	O14645 Main function of 5'-partner protein: FUNCTION: May play a dynamic role in flagellar motility.	Q15052 Main function of 5'-partner protein: FUNCTION: Acts as a RAC1 guanine nucleotide exchange factor (GEF).
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000296218, ENST00000541606, ENST00000497858,	ENST00000250617, ENST00000370620, ENST00000370622, ENST00000535227,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 3 X 2=12	4 X 3 X 3=36
	# samples	2	4
	** MAII score	log2(2/12*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(4/36*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: DNALI1 [Title/Abstract] AND ARHGEF6 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DNALI1 [Title/Abstract] AND ARHGEF6 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DNALI1(38025097)-ARHGEF6(135790929), # samples:1 DNALI1(38023349)-ARHGEF6(135790929), # samples:1
Anticipated loss of major functional domain due to fusion event.	DNALI1-ARHGEF6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNALI1-ARHGEF6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNALI1-ARHGEF6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DNALI1-ARHGEF6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DNALI1-ARHGEF6 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:38025097/chrX:135790929)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DNALI1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ARHGEF6 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000296218	DNALI1	chr1	38023349	-	ENST00000370620	ARHGEF6	chrX	135790929	-	4289	303	10	1806	598
ENST00000296218	DNALI1	chr1	38023349	-	ENST00000370622	ARHGEF6	chrX	135790929	-	4289	303	10	1806	598
ENST00000296218	DNALI1	chr1	38023349	-	ENST00000250617	ARHGEF6	chrX	135790929	-	4289	303	10	1806	598
ENST00000296218	DNALI1	chr1	38023349	-	ENST00000535227	ARHGEF6	chrX	135790929	-	2049	303	10	1806	598

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000296218	ENST00000370620	DNALI1	chr1	38023349	-	ARHGEF6	chrX	135790929	-	0.000778406	0.99922156
ENST00000296218	ENST00000370622	DNALI1	chr1	38023349	-	ARHGEF6	chrX	135790929	-	0.000778406	0.99922156
ENST00000296218	ENST00000250617	DNALI1	chr1	38023349	-	ARHGEF6	chrX	135790929	-	0.000778406	0.99922156
ENST00000296218	ENST00000535227	DNALI1	chr1	38023349	-	ARHGEF6	chrX	135790929	-	0.002080973	0.997919

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DNALI1-ARHGEF6

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DNALI1	chr1	38023349	ARHGEF6	chrX	135790929	303	97	KQAEEILNAILPPSLSTVEVTSLLGN

Top

Potential FusionNeoAntigen Information of DNALI1-ARHGEF6 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DNALI1-ARHGEF6_38023349_135790929.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B35:03	NAILPPSL	0.9939	0.9163	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B35:02	NAILPPSL	0.9874	0.9571	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B35:04	NAILPPSL	0.9874	0.9571	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:22	ILPPSLSTV	0.9978	0.8477	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:13	ILPPSLSTV	0.9966	0.8353	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:27	ILPPSLSTV	0.9961	0.8047	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:11	ILPPSLSTV	0.9956	0.8734	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:60	ILPPSLSTV	0.9952	0.8594	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:21	ILPPSLSTV	0.9952	0.91	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:24	ILPPSLSTV	0.9952	0.8642	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:67	ILPPSLSTV	0.9952	0.8642	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:30	ILPPSLSTV	0.9952	0.8642	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:16	ILPPSLSTV	0.9928	0.5931	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:38	ILPPSLSTV	0.992	0.6976	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:04	ILPPSLSTV	0.9901	0.8984	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:19	ILPPSLSTV	0.9896	0.7256	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:35	ILPPSLSTV	0.9869	0.8722	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:29	ILPPSLSTV	0.9853	0.8608	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:17	ILPPSLSTV	0.9813	0.8378	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:20	ILPPSLSTV	0.978	0.8693	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B52:01	ILPPSLSTV	0.5573	0.9814	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:13	AILPPSLSTV	0.9966	0.8119	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:27	AILPPSLSTV	0.9957	0.7686	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:22	AILPPSLSTV	0.9947	0.7839	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:38	AILPPSLSTV	0.9942	0.766	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:11	AILPPSLSTV	0.9932	0.7928	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:21	AILPPSLSTV	0.993	0.8555	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:60	AILPPSLSTV	0.9926	0.7822	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:16	AILPPSLSTV	0.9925	0.6034	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:24	AILPPSLSTV	0.9924	0.7792	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:67	AILPPSLSTV	0.9924	0.7792	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:30	AILPPSLSTV	0.9924	0.7792	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:04	AILPPSLSTV	0.9898	0.8538	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:17	AILPPSLSTV	0.9832	0.8123	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:04	ILNAILPPSL	0.9807	0.648	5	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:19	AILPPSLSTV	0.9774	0.7474	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:35	AILPPSLSTV	0.9719	0.7949	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:29	AILPPSLSTV	0.9638	0.7793	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:20	AILPPSLSTV	0.9307	0.7856	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:22	ILPPSLSTVEV	0.9966	0.8223	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:13	ILPPSLSTVEV	0.9965	0.8159	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:27	ILPPSLSTVEV	0.9947	0.7256	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:21	ILPPSLSTVEV	0.9878	0.9069	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:11	ILPPSLSTVEV	0.9852	0.8696	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:24	ILPPSLSTVEV	0.9842	0.8495	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:67	ILPPSLSTVEV	0.9842	0.8495	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:30	ILPPSLSTVEV	0.9842	0.8495	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:60	ILPPSLSTVEV	0.9841	0.8478	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:04	ILPPSLSTVEV	0.9799	0.8493	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:38	ILPPSLSTVEV	0.9788	0.6751	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:19	ILPPSLSTVEV	0.9763	0.7049	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:35	ILPPSLSTVEV	0.9739	0.8609	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:17	ILPPSLSTVEV	0.9687	0.8243	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:29	ILPPSLSTVEV	0.9551	0.8463	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:20	ILPPSLSTVEV	0.9482	0.8553	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C03:08	NAILPPSL	0.9999	0.9282	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C03:19	NAILPPSL	0.9999	0.9906	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B78:01	LPPSLSTV	0.9995	0.6316	10	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B51:07	NAILPPSL	0.999	0.775	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C08:04	NAILPPSL	0.9917	0.9508	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C08:13	NAILPPSL	0.9917	0.9508	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B35:12	NAILPPSL	0.9874	0.9571	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C08:03	NAILPPSL	0.9152	0.9758	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:02	ILPPSLSTV	0.9979	0.6846	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:05	ILPPSLSTV	0.9978	0.789	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:07	ILPPSLSTV	0.9955	0.8792	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:01	ILPPSLSTV	0.9952	0.8642	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C05:09	ILPPSLSTV	0.9714	0.9898	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C04:10	ILPPSLSTV	0.9482	0.9387	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C04:06	ILPPSLSTV	0.9423	0.9818	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C04:07	ILPPSLSTV	0.9394	0.9499	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C04:14	ILPPSLSTV	0.9307	0.9543	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:30	ILPPSLSTV	0.6294	0.9847	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:17	ILPPSLSTV	0.6084	0.9795	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C02:06	ILPPSLSTV	0.5418	0.9786	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C07:13	ILPPSLSTV	0.0636	0.9845	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C07:29	ILPPSLSTV	0.0614	0.9866	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:05	AILPPSLSTV	0.9954	0.7563	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:02	AILPPSLSTV	0.995	0.6627	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:07	AILPPSLSTV	0.9933	0.8153	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:01	AILPPSLSTV	0.9924	0.7792	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:07	ILPPSLSTVE	0.7584	0.8484	9	19
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:17	AILPPSLSTV	0.6533	0.9829	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:02	ILPPSLSTVEV	0.9968	0.6341	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:05	ILPPSLSTVEV	0.9965	0.7485	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:07	ILPPSLSTVEV	0.9864	0.8671	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:01	ILPPSLSTVEV	0.9842	0.8495	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:07	NAILPPSLSTV	0.9136	0.6419	7	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:17	ILPPSLSTVEV	0.8297	0.9801	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C03:17	NAILPPSL	0.9999	0.9729	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C03:04	NAILPPSL	0.9999	0.991	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C03:03	NAILPPSL	0.9999	0.991	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C03:05	NAILPPSL	0.9998	0.941	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B78:02	LPPSLSTV	0.9996	0.8082	10	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B78:02	NAILPPSL	0.9988	0.5178	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B51:21	LPPSLSTV	0.9985	0.5233	10	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C03:06	NAILPPSL	0.9969	0.9916	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B35:13	NAILPPSL	0.9957	0.9201	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C16:04	NAILPPSL	0.9952	0.9885	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C16:01	NAILPPSL	0.9903	0.974	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B35:09	NAILPPSL	0.9874	0.9571	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B08:12	NAILPPSL	0.9531	0.8238	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C08:01	NAILPPSL	0.9152	0.9758	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B59:01	LPPSLSTV	0.8905	0.5237	10	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B07:13	NAILPPSL	0.8098	0.8546	7	15
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:03	ILPPSLSTV	0.9987	0.8837	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:14	ILPPSLSTV	0.9956	0.9026	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:06	ILPPSLSTV	0.9952	0.91	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C05:01	ILPPSLSTV	0.9714	0.9898	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C04:03	ILPPSLSTV	0.9695	0.9657	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C04:01	ILPPSLSTV	0.9394	0.9499	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B15:73	ILPPSLSTV	0.9361	0.9612	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C18:01	ILPPSLSTV	0.9358	0.9451	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B15:30	ILPPSLSTV	0.8805	0.9225	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C06:06	ILPPSLSTV	0.8544	0.9925	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C04:04	ILPPSLSTV	0.8402	0.9778	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:03	ILPPSLSTV	0.6964	0.9407	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:02	ILPPSLSTV	0.5918	0.978	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C17:01	ILPPSLSTV	0.55	0.9488	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C07:04	ILPPSLSTV	0.0941	0.9643	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B07:13	ILPPSLSTV	0.0294	0.8429	9	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:03	AILPPSLSTV	0.9974	0.7906	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:14	AILPPSLSTV	0.9933	0.8384	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:06	AILPPSLSTV	0.993	0.8555	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B51:13	LPPSLSTVEV	0.9629	0.5139	10	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B51:14	LPPSLSTVEV	0.9573	0.5013	10	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-B51:09	LPPSLSTVEV	0.9447	0.5171	10	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:03	AILPPSLSTV	0.8312	0.9398	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:02	AILPPSLSTV	0.6498	0.9826	8	18
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:03	ILPPSLSTVEV	0.9989	0.8551	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:14	ILPPSLSTVEV	0.9883	0.8894	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-A02:06	ILPPSLSTVEV	0.9878	0.9069	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:03	ILPPSLSTVEV	0.9232	0.961	9	20
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	303	HLA-C01:02	ILPPSLSTVEV	0.8434	0.979	9	20

Top

Potential FusionNeoAntigen Information of DNALI1-ARHGEF6 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of DNALI1-ARHGEF6

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5318	LNAILPPSLSTVEV	DNALI1	ARHGEF6	chr1	38023349	chrX	135790929	303

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DNALI1-ARHGEF6

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5318	LNAILPPSLSTVEV	-7.9962	-8.1096
HLA-B14:02	3BVN	5318	LNAILPPSLSTVEV	-5.70842	-6.74372
HLA-B52:01	3W39	5318	LNAILPPSLSTVEV	-6.83737	-6.95077
HLA-B52:01	3W39	5318	LNAILPPSLSTVEV	-4.4836	-5.5189
HLA-A11:01	4UQ2	5318	LNAILPPSLSTVEV	-10.0067	-10.1201
HLA-A11:01	4UQ2	5318	LNAILPPSLSTVEV	-9.03915	-10.0745
HLA-A24:02	5HGA	5318	LNAILPPSLSTVEV	-6.56204	-6.67544
HLA-A24:02	5HGA	5318	LNAILPPSLSTVEV	-5.42271	-6.45801
HLA-B44:05	3DX8	5318	LNAILPPSLSTVEV	-7.85648	-8.89178
HLA-B44:05	3DX8	5318	LNAILPPSLSTVEV	-5.3978	-5.5112
HLA-A02:01	6TDR	5318	LNAILPPSLSTVEV	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of DNALI1-ARHGEF6

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	10	18	LPPSLSTV	ACCCCCAAGTCTGAGTACTGTGGA
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	10	20	LPPSLSTVEV	ACCCCCAAGTCTGAGTACTGTGGAGGTTAC
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	5	15	ILNAILPPSL	CTTGAATGCCATACTACCCCCAAGTCTGAG
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	7	15	NAILPPSL	TGCCATACTACCCCCAAGTCTGAG
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	7	18	NAILPPSLSTV	TGCCATACTACCCCCAAGTCTGAGTACTGTGGA
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	8	18	AILPPSLSTV	CATACTACCCCCAAGTCTGAGTACTGTGGA
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	9	18	ILPPSLSTV	ACTACCCCCAAGTCTGAGTACTGTGGA
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	9	19	ILPPSLSTVE	ACTACCCCCAAGTCTGAGTACTGTGGAGGT
DNALI1-ARHGEF6	chr1	38023349	chrX	135790929	9	20	ILPPSLSTVEV	ACTACCCCCAAGTCTGAGTACTGTGGAGGTTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of DNALI1-ARHGEF6

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	DNALI1-ARHGEF6	chr1	38023349	ENST00000296218	chrX	135790929	ENST00000250617	TCGA-71-8520-01A

Top

Potential target of CAR-T therapy development for DNALI1-ARHGEF6

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DNALI1-ARHGEF6

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DNALI1-ARHGEF6

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)