Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DNMT3B-DUSP15

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DNMT3B-DUSP15
	FusionPDB ID: 23716
	FusionGDB2.0 ID: 23716
		Hgene	Tgene
	Gene symbol	DNMT3B	DUSP15
	Gene ID	1789	128853
	Gene name	DNA methyltransferase 3 beta	dual specificity phosphatase 15
	Synonyms	ICF\|ICF1\|M.HsaIIIB	C20orf57\|VHY
	Cytomap	20q11.21	20q11.21
	Type of gene	protein-coding	protein-coding
	Description	DNA (cytosine-5)-methyltransferase 3BDNA (cytosine-5-)-methyltransferase 3 betaDNA MTase HsaIIIBDNA cytosine-5--methyltransferase 3 betaDNA methyltransferase HsaIIIB	dual specificity protein phosphatase 15VH1-related member Ydual specificity phosphatase-like 15vaccinia virus VH1-related dual-specific protein phosphatase Y
	Modification date	20200313	20200313
	UniProtAcc	Q9UBC3 Main function of 5'-partner protein: FUNCTION: Required for genome-wide de novo methylation and is essential for the establishment of DNA methylation patterns during development. DNA methylation is coordinated with methylation of histones. May preferentially methylates nucleosomal DNA within the nucleosome core region. May function as transcriptional co-repressor by associating with CBX4 and independently of DNA methylation. Seems to be involved in gene silencing (By similarity). In association with DNMT1 and via the recruitment of CTCFL/BORIS, involved in activation of BAG1 gene expression by modulating dimethylation of promoter histone H3 at H3K4 and H3K9. Isoforms 4 and 5 are probably not functional due to the deletion of two conserved methyltransferase motifs. Functions as a transcriptional corepressor by associating with ZHX1. Required for DUX4 silencing in somatic cells (PubMed:27153398). {ECO:0000250, ECO:0000269\|PubMed:16357870, ECO:0000269\|PubMed:17303076, ECO:0000269\|PubMed:18413740, ECO:0000269\|PubMed:18567530, ECO:0000269\|PubMed:27153398}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000201963, ENST00000328111, ENST00000344505, ENST00000348286, ENST00000353855, ENST00000375623, ENST00000443239, ENST00000456297,	ENST00000339738, ENST00000375966, ENST00000398083, ENST00000398084, ENST00000486996, ENST00000493115, ENST00000278979,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 7 X 5=245	5 X 3 X 4=60
	# samples	8	5
	** MAII score	log2(8/245*10)=-1.61470984411521 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/60*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: DNMT3B [Title/Abstract] AND DUSP15 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DNMT3B [Title/Abstract] AND DUSP15 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DNMT3B(31376818)-DUSP15(30457400), # samples:3
Anticipated loss of major functional domain due to fusion event.	DNMT3B-DUSP15 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNMT3B-DUSP15 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNMT3B-DUSP15 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DNMT3B-DUSP15 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	DNMT3B	GO:0000122	negative regulation of transcription by RNA polymerase II	17303076
Tgene	DUSP15	GO:0016311	dephosphorylation	24531476

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:31376818/chr20:30457400)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DNMT3B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DUSP15 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000328111	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2777	1134	117	2009	630
ENST00000348286	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2738	1095	78	1970	630
ENST00000353855	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2738	1095	78	1970	630
ENST00000443239	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2440	797	95	1672	525
ENST00000344505	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2553	910	82	1785	567
ENST00000375623	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2418	775	73	1650	525
ENST00000456297	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2292	649	49	1524	491
ENST00000201963	DNMT3B	chr20	31376818	+	ENST00000278979	DUSP15	chr20	30457400	-	2756	1113	219	1988	589

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000328111	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.088169314	0.91183066
ENST00000348286	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.08992793	0.91007215
ENST00000353855	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.08992793	0.91007215
ENST00000443239	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.0891941	0.9108059
ENST00000344505	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.083743855	0.9162561
ENST00000375623	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.08750452	0.91249543
ENST00000456297	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.14718117	0.8528188
ENST00000201963	ENST00000278979	DNMT3B	chr20	31376818	+	DUSP15	chr20	30457400	-	0.067844935	0.9321551

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DNMT3B-DUSP15

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DNMT3B	chr20	31376818	DUSP15	chr20	30457400	1095	339	RWVQWFGDGKFSEVLPGLYLGNFIDA
DNMT3B	chr20	31376818	DUSP15	chr20	30457400	1113	298	RWVQWFGDGKFSEVLPGLYLGNFIDA
DNMT3B	chr20	31376818	DUSP15	chr20	30457400	1134	339	RWVQWFGDGKFSEVLPGLYLGNFIDA
DNMT3B	chr20	31376818	DUSP15	chr20	30457400	649	200	RWVQWFGDGKFSEVLPGLYLGNFIDA
DNMT3B	chr20	31376818	DUSP15	chr20	30457400	775	234	RWVQWFGDGKFSEVLPGLYLGNFIDA
DNMT3B	chr20	31376818	DUSP15	chr20	30457400	797	234	RWVQWFGDGKFSEVLPGLYLGNFIDA
DNMT3B	chr20	31376818	DUSP15	chr20	30457400	910	276	RWVQWFGDGKFSEVLPGLYLGNFIDA

Top

Potential FusionNeoAntigen Information of DNMT3B-DUSP15 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DNMT3B-DUSP15_31376818_30457400.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:03	SEVLPGLY	0.9995	0.928	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:01	SEVLPGLY	0.9955	0.9348	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B47:01	SEVLPGLY	0.9922	0.5531	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B13:01	SEVLPGLYL	0.9876	0.8842	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-A02:21	FGDGKFSEV	0.9813	0.688	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B50:02	SEVLPGLYL	0.9708	0.5499	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:03	SEVLPGLYL	0.9671	0.96	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B47:01	SEVLPGLYL	0.9298	0.6531	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B45:01	SEVLPGLYL	0.8476	0.8141	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:01	SEVLPGLYL	0.7685	0.9544	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B08:09	FGDGKFSEV	0.4199	0.928	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B41:01	SEVLPGLYL	0.3923	0.9144	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B39:13	SEVLPGLYL	0.3482	0.9498	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B50:01	SEVLPGLYL	0.1843	0.745	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:10	FGDGKFSEV	0.9999	0.9734	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C05:09	FGDGKFSEV	0.9999	0.992	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:15	FGDGKFSEV	0.9998	0.9936	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:07	FGDGKFSEV	0.9998	0.9647	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C01:17	FGDGKFSEV	0.9997	0.9791	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C15:06	FGDGKFSEV	0.9986	0.9694	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:06	FGDGKFSEV	0.9979	0.985	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B40:06	SEVLPGLYL	0.9973	0.5969	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C03:19	FGDGKFSEV	0.9943	0.9899	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C01:30	FGDGKFSEV	0.9864	0.9736	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:04	FGDGKFSEV	0.9788	0.9939	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:13	FGDGKFSEV	0.9788	0.9939	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-A02:07	FGDGKFSEV	0.9758	0.6223	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:14	FGDGKFSEV	0.92	0.972	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:03	FGDGKFSEV	0.8822	0.995	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C02:06	FGDGKFSEV	0.8791	0.9876	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C07:29	KFSEVLPGL	0.6865	0.9562	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C07:13	KFSEVLPGL	0.657	0.9591	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:14	KFSEVLPGL	0.6368	0.9302	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B39:08	SEVLPGLYL	0.563	0.7676	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C15:04	FSEVLPGLY	0.5407	0.8958	10	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C07:13	FGDGKFSEV	0.4867	0.974	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C05:09	FGDGKFSEVL	1	0.9829	5	15
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:15	FGDGKFSEVL	0.9999	0.991	5	15
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C05:09	FSEVLPGLYL	0.9999	0.9437	10	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:26	SEVLPGLY	0.9995	0.928	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:13	SEVLPGLY	0.9995	0.928	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:07	SEVLPGLY	0.9995	0.928	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:08	SEVLPGLY	0.9969	0.9199	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:04	SEVLPGLY	0.9961	0.9371	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:06	SEVLPGLY	0.9955	0.944	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:05	SEVLPGLY	0.9955	0.9348	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:11	SEVLPGLY	0.9826	0.9165	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:03	SEVLPGLY	0.9758	0.9273	11	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C18:01	FGDGKFSEV	0.9999	0.969	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C05:01	FGDGKFSEV	0.9999	0.992	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:03	FGDGKFSEV	0.9999	0.9729	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C01:03	FGDGKFSEV	0.9998	0.9797	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:02	FGDGKFSEV	0.9998	0.9936	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:01	FGDGKFSEV	0.9998	0.9647	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C01:02	FGDGKFSEV	0.9997	0.98	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C15:02	FGDGKFSEV	0.9988	0.9762	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C15:05	FGDGKFSEV	0.9987	0.9835	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B40:04	SEVLPGLYL	0.9972	0.7168	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C03:06	FGDGKFSEV	0.9883	0.9905	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-A02:14	FGDGKFSEV	0.9816	0.6404	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-A02:06	FGDGKFSEV	0.9813	0.688	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:04	FGDGKFSEV	0.9706	0.9831	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:26	SEVLPGLYL	0.9671	0.96	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:13	SEVLPGLYL	0.9671	0.96	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B44:07	SEVLPGLYL	0.9671	0.96	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C17:01	FGDGKFSEV	0.9193	0.9914	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:01	FGDGKFSEV	0.8822	0.995	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C18:01	KFSEVLPGL	0.8776	0.8976	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:08	SEVLPGLYL	0.7735	0.964	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:05	SEVLPGLYL	0.7685	0.9544	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:06	SEVLPGLYL	0.7456	0.966	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:04	KFSEVLPGL	0.717	0.9351	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:11	SEVLPGLYL	0.6929	0.965	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B18:03	SEVLPGLYL	0.6909	0.9496	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C07:04	FGDGKFSEV	0.6402	0.9735	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C03:02	FSEVLPGLY	0.5963	0.9476	10	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C15:09	FSEVLPGLY	0.5407	0.8958	10	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B39:11	SEVLPGLYL	0.5379	0.7421	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C14:02	KFSEVLPGL	0.5279	0.9375	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C14:03	KFSEVLPGL	0.5279	0.9375	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C06:06	KFSEVLPGL	0.5129	0.9842	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C07:04	KFSEVLPGL	0.3246	0.9675	9	18
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B39:31	SEVLPGLYL	0.3111	0.9707	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B39:02	SEVLPGLYL	0.2873	0.9566	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B07:13	FGDGKFSEV	0.2512	0.892	5	14
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B50:04	SEVLPGLYL	0.1843	0.745	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B50:05	SEVLPGLYL	0.1843	0.745	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B48:02	SEVLPGLYL	0.1057	0.9587	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C02:02	FSEVLPGLY	0.0343	0.9657	10	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C02:10	FSEVLPGLY	0.0343	0.9657	10	19
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-B15:53	SEVLPGLYL	0.0054	0.9301	11	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C05:01	FGDGKFSEVL	1	0.9829	5	15
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C04:03	FGDGKFSEVL	1	0.9704	5	15
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C05:01	FSEVLPGLYL	0.9999	0.9437	10	20
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	HLA-C08:02	FGDGKFSEVL	0.9999	0.991	5	15

Top

Potential FusionNeoAntigen Information of DNMT3B-DUSP15 in HLA II

DNMT3B-DUSP15_31376818_30457400.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1113	DRB1-1333	WVQWFGDGKFSEVLP	1	16

Top

Fusion breakpoint peptide structures of DNMT3B-DUSP15

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2704	GDGKFSEVLPGLYL	DNMT3B	DUSP15	chr20	31376818	chr20	30457400	1113

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DNMT3B-DUSP15

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2704	GDGKFSEVLPGLYL	-7.9962	-8.1096
HLA-B14:02	3BVN	2704	GDGKFSEVLPGLYL	-5.70842	-6.74372
HLA-B52:01	3W39	2704	GDGKFSEVLPGLYL	-6.83737	-6.95077
HLA-B52:01	3W39	2704	GDGKFSEVLPGLYL	-4.4836	-5.5189
HLA-A11:01	4UQ2	2704	GDGKFSEVLPGLYL	-10.0067	-10.1201
HLA-A11:01	4UQ2	2704	GDGKFSEVLPGLYL	-9.03915	-10.0745
HLA-A24:02	5HGA	2704	GDGKFSEVLPGLYL	-6.56204	-6.67544
HLA-A24:02	5HGA	2704	GDGKFSEVLPGLYL	-5.42271	-6.45801
HLA-B44:05	3DX8	2704	GDGKFSEVLPGLYL	-7.85648	-8.89178
HLA-B44:05	3DX8	2704	GDGKFSEVLPGLYL	-5.3978	-5.5112
HLA-A02:01	6TDR	2704	GDGKFSEVLPGLYL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of DNMT3B-DUSP15

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	10	19	FSEVLPGLY	TTCTCCGAGGTACTTCCTGGACTCTAC
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	10	20	FSEVLPGLYL	TTCTCCGAGGTACTTCCTGGACTCTACCTC
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	11	19	SEVLPGLY	TCCGAGGTACTTCCTGGACTCTAC
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	11	20	SEVLPGLYL	TCCGAGGTACTTCCTGGACTCTACCTC
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	5	14	FGDGKFSEV	TTTGGCGATGGCAAGTTCTCCGAGGTA
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	5	15	FGDGKFSEVL	TTTGGCGATGGCAAGTTCTCCGAGGTACTT
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	9	18	KFSEVLPGL	AAGTTCTCCGAGGTACTTCCTGGACTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
DNMT3B-DUSP15	chr20	31376818	chr20	30457400	1	16	WVQWFGDGKFSEVLP	TGGGTCCAGTGGTTTGGCGATGGCAAGTTCTCCGAGGTACTTCCT

Top

Information of the samples that have these potential fusion neoantigens of DNMT3B-DUSP15

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	DNMT3B-DUSP15	chr20	31376818	ENST00000201963	chr20	30457400	ENST00000278979	TCGA-K4-A3WS-01A

Top

Potential target of CAR-T therapy development for DNMT3B-DUSP15

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DNMT3B-DUSP15

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DNMT3B-DUSP15

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)