![]() |
|||||||
|
Fusion Protein:DOCK7-ADAM32 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: DOCK7-ADAM32 | FusionPDB ID: 23826 | FusionGDB2.0 ID: 23826 | Hgene | Tgene | Gene symbol | DOCK7 | ADAM32 | Gene ID | 85440 | 203102 |
Gene name | dedicator of cytokinesis 7 | ADAM metallopeptidase domain 32 | |
Synonyms | EIEE23|ZIR2 | - | |
Cytomap | 1p31.3 | 8p11.22 | |
Type of gene | protein-coding | protein-coding | |
Description | dedicator of cytokinesis protein 7 | disintegrin and metalloproteinase domain-containing protein 32a disintegrin and metalloprotease domain 32a disintegrin and metalloproteinase domain 32metalloproteinase 12-like proteintesticular tissue protein Li 13 | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | Q96N67 Main function of 5'-partner protein: FUNCTION: Functions as a guanine nucleotide exchange factor (GEF), which activates Rac1 and Rac3 Rho small GTPases by exchanging bound GDP for free GTP. Does not have a GEF activity for CDC42. Required for STMN1 'Ser-15' phosphorylation during axon formation and consequently for neuronal polarization (PubMed:16982419). As part of the DISP complex, may regulate the association of septins with actin and thereby regulate the actin cytoskeleton (PubMed:29467281). Has a role in pigmentation (By similarity). Involved in the regulation of cortical neurogenesis through the control of radial glial cells (RGCs) proliferation versus differentiation; negatively regulates the basal-to-apical interkinetic nuclear migration of RGCs by antagonizing the microtubule growth-promoting function of TACC3 (By similarity). {ECO:0000250|UniProtKB:Q8R1A4, ECO:0000269|PubMed:16982419, ECO:0000269|PubMed:29467281}. | Q8TC27 Main function of 5'-partner protein: FUNCTION: May play a role in sperm development and fertilization This is a non-catalytic metalloprotease-like protein. {ECO:0000250}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000251157, ENST00000340370, ENST00000404627, ENST00000489185, | ENST00000524303, ENST00000379907, ENST00000437682, ENST00000519315, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 12 X 7=1092 | 11 X 12 X 8=1056 |
# samples | 14 | 13 | |
** MAII score | log2(14/1092*10)=-2.96347412397489 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(13/1056*10)=-3.02202630633 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: DOCK7 [Title/Abstract] AND ADAM32 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: DOCK7 [Title/Abstract] AND ADAM32 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | DOCK7(63018403)-ADAM32(39080559), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | DOCK7-ADAM32 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DOCK7-ADAM32 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DOCK7-ADAM32 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DOCK7-ADAM32 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | DOCK7 | GO:0090630 | activation of GTPase activity | 16982419 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:63018403/chr8:39080559) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000251157 | DOCK7 | chr1 | 63018403 | - | ENST00000437682 | ADAM32 | chr8 | 39080559 | + | 3948 | 2800 | 34 | 3837 | 1267 |
ENST00000251157 | DOCK7 | chr1 | 63018403 | - | ENST00000519315 | ADAM32 | chr8 | 39080559 | + | 3792 | 2800 | 34 | 3681 | 1215 |
ENST00000251157 | DOCK7 | chr1 | 63018403 | - | ENST00000379907 | ADAM32 | chr8 | 39080559 | + | 3948 | 2800 | 34 | 3837 | 1267 |
ENST00000340370 | DOCK7 | chr1 | 63018403 | - | ENST00000437682 | ADAM32 | chr8 | 39080559 | + | 3932 | 2784 | 18 | 3821 | 1267 |
ENST00000340370 | DOCK7 | chr1 | 63018403 | - | ENST00000519315 | ADAM32 | chr8 | 39080559 | + | 3776 | 2784 | 18 | 3665 | 1215 |
ENST00000340370 | DOCK7 | chr1 | 63018403 | - | ENST00000379907 | ADAM32 | chr8 | 39080559 | + | 3932 | 2784 | 18 | 3821 | 1267 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000251157 | ENST00000437682 | DOCK7 | chr1 | 63018403 | - | ADAM32 | chr8 | 39080559 | + | 0.000311945 | 0.999688 |
ENST00000251157 | ENST00000519315 | DOCK7 | chr1 | 63018403 | - | ADAM32 | chr8 | 39080559 | + | 0.000257192 | 0.9997428 |
ENST00000251157 | ENST00000379907 | DOCK7 | chr1 | 63018403 | - | ADAM32 | chr8 | 39080559 | + | 0.000311945 | 0.999688 |
ENST00000340370 | ENST00000437682 | DOCK7 | chr1 | 63018403 | - | ADAM32 | chr8 | 39080559 | + | 0.000293494 | 0.99970645 |
ENST00000340370 | ENST00000519315 | DOCK7 | chr1 | 63018403 | - | ADAM32 | chr8 | 39080559 | + | 0.000244096 | 0.9997559 |
ENST00000340370 | ENST00000379907 | DOCK7 | chr1 | 63018403 | - | ADAM32 | chr8 | 39080559 | + | 0.000293494 | 0.99970645 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for DOCK7-ADAM32 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
DOCK7 | chr1 | 63018403 | ADAM32 | chr8 | 39080559 | 2784 | 920 | PTSPDDEVRSIIGSKILQSGVECRPK |
DOCK7 | chr1 | 63018403 | ADAM32 | chr8 | 39080559 | 2800 | 920 | PTSPDDEVRSIIGSKILQSGVECRPK |
Top |
Potential FusionNeoAntigen Information of DOCK7-ADAM32 in HLA I |
![]() |
DOCK7-ADAM32_63018403_39080559.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-B27:04 | VRSIIGSKI | 0.9986 | 0.6637 | 7 | 16 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-B15:17 | RSIIGSKIL | 0.986 | 0.7326 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C15:06 | RSIIGSKIL | 0.9986 | 0.8168 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C03:08 | RSIIGSKIL | 0.9969 | 0.7556 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-B27:06 | VRSIIGSKI | 0.9986 | 0.6442 | 7 | 16 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C15:02 | RSIIGSKIL | 0.9983 | 0.8139 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C15:05 | RSIIGSKIL | 0.9982 | 0.8714 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-B27:09 | VRSIIGSKI | 0.9973 | 0.8023 | 7 | 16 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C03:17 | RSIIGSKIL | 0.9959 | 0.9624 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C03:05 | RSIIGSKIL | 0.9955 | 0.8958 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-B58:06 | RSIIGSKIL | 0.9842 | 0.5959 | 8 | 17 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C06:08 | VRSIIGSKI | 0.909 | 0.9831 | 7 | 16 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-A30:01 | EVRSIIGSK | 0.9028 | 0.7903 | 6 | 15 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C06:02 | VRSIIGSKI | 0.0104 | 0.9865 | 7 | 16 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | HLA-C06:17 | VRSIIGSKI | 0.0104 | 0.9865 | 7 | 16 |
Top |
Potential FusionNeoAntigen Information of DOCK7-ADAM32 in HLA II |
![]() |
DOCK7-ADAM32_63018403_39080559.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | DRB1-0102 | DDEVRSIIGSKILQS | 4 | 19 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | DRB1-0102 | PDDEVRSIIGSKILQ | 3 | 18 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | DRB1-0123 | DDEVRSIIGSKILQS | 4 | 19 |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 | DRB1-1615 | DDEVRSIIGSKILQS | 4 | 19 |
Top |
Fusion breakpoint peptide structures of DOCK7-ADAM32 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2235 | EVRSIIGSKILQSG | DOCK7 | ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 2800 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DOCK7-ADAM32 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2235 | EVRSIIGSKILQSG | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 2235 | EVRSIIGSKILQSG | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 2235 | EVRSIIGSKILQSG | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 2235 | EVRSIIGSKILQSG | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 2235 | EVRSIIGSKILQSG | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 2235 | EVRSIIGSKILQSG | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 2235 | EVRSIIGSKILQSG | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 2235 | EVRSIIGSKILQSG | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 2235 | EVRSIIGSKILQSG | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 2235 | EVRSIIGSKILQSG | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 2235 | EVRSIIGSKILQSG | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of DOCK7-ADAM32 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 6 | 15 | EVRSIIGSK | CGATCAATCATCGGGAGTAAGATTTTA |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 7 | 16 | VRSIIGSKI | TCAATCATCGGGAGTAAGATTTTACAA |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 8 | 17 | RSIIGSKIL | ATCATCGGGAGTAAGATTTTACAATCA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 3 | 18 | PDDEVRSIIGSKILQ | GATGAAGTTCGATCAATCATCGGGAGTAAGATTTTACAATCAGGC |
DOCK7-ADAM32 | chr1 | 63018403 | chr8 | 39080559 | 4 | 19 | DDEVRSIIGSKILQS | GAAGTTCGATCAATCATCGGGAGTAAGATTTTACAATCAGGCGTT |
Top |
Information of the samples that have these potential fusion neoantigens of DOCK7-ADAM32 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SARC | DOCK7-ADAM32 | chr1 | 63018403 | ENST00000251157 | chr8 | 39080559 | ENST00000379907 | TCGA-SG-A849-01A |
Top |
Potential target of CAR-T therapy development for DOCK7-ADAM32 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | ADAM32 | chr1:63018403 | chr8:39080559 | ENST00000379907 | 12 | 25 | 683_703 | 0 | 788.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to DOCK7-ADAM32 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to DOCK7-ADAM32 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |