![]() |
|||||||
|
Fusion Protein:ADH1B-ALB |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ADH1B-ALB | FusionPDB ID: 2410 | FusionGDB2.0 ID: 2410 | Hgene | Tgene | Gene symbol | ADH1B | ALB | Gene ID | 125 | 213 |
Gene name | alcohol dehydrogenase 1B (class I), beta polypeptide | albumin | |
Synonyms | ADH2|HEL-S-117 | HSA|PRO0883|PRO0903|PRO1341 | |
Cytomap | 4q23 | 4q13.3 | |
Type of gene | protein-coding | protein-coding | |
Description | all-trans-retinol dehydrogenase [NAD(+)] ADH1BADH, beta subunitalcohol dehydrogenase 2 (class I), beta polypeptidealcohol dehydrogenase subunit betaaldehyde reductaseepididymis secretory protein Li 117 | serum albumin | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | P00325 Main function of 5'-partner protein: FUNCTION: Catalyzes the NAD-dependent oxidation of all-trans-retinol and its derivatives such as all-trans-4-hydroxyretinol and may participate in retinoid metabolism (PubMed:15369820, PubMed:16787387). In vitro can also catalyzes the NADH-dependent reduction of all-trans-retinal and its derivatives such as all-trans-4-oxoretinal (PubMed:15369820, PubMed:16787387). Catalyzes in the oxidative direction with higher efficiency (PubMed:16787387). Has the same affinity for all-trans-4-hydroxyretinol and all-trans-4-oxoretinal (PubMed:15369820). {ECO:0000269|PubMed:15369820, ECO:0000269|PubMed:16787387}. | P02768 Main function of 5'-partner protein: FUNCTION: Binds water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs (Probable). Its main function is the regulation of the colloidal osmotic pressure of blood (Probable). Major zinc transporter in plasma, typically binds about 80% of all plasma zinc (PubMed:19021548). Major calcium and magnesium transporter in plasma, binds approximately 45% of circulating calcium and magnesium in plasma (By similarity). Potentially has more than two calcium-binding sites and might additionally bind calcium in a non-specific manner (By similarity). The shared binding site between zinc and calcium at residue Asp-273 suggests a crosstalk between zinc and calcium transport in the blood (By similarity). The rank order of affinity is zinc > calcium > magnesium (By similarity). Binds to the bacterial siderophore enterobactin and inhibits enterobactin-mediated iron uptake of E.coli from ferric transferrin, and may thereby limit the utilization of iron and growth of enteric bacteria such as E.coli (PubMed:6234017). Does not prevent iron uptake by the bacterial siderophore aerobactin (PubMed:6234017). {ECO:0000250|UniProtKB:P02769, ECO:0000269|PubMed:19021548, ECO:0000269|PubMed:6234017, ECO:0000305|PubMed:1630489}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000305046, ENST00000394887, ENST00000504498, | ENST00000505649, ENST00000295897, ENST00000401494, ENST00000415165, ENST00000503124, ENST00000509063, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 3 X 3 X 2=18 | 49 X 62 X 5=15190 |
# samples | 3 | 64 | |
** MAII score | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(64/15190*10)=-4.56890615450208 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ADH1B [Title/Abstract] AND ALB [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ADH1B [Title/Abstract] AND ALB [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ADH1B(100242471)-ALB(74279137), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ADH1B-ALB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADH1B-ALB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADH1B-ALB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ADH1B-ALB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ADH1B | GO:0001523 | retinoid metabolic process | 15369820|16787387 |
Hgene | ADH1B | GO:0006069 | ethanol oxidation | 2398055 |
Tgene | ALB | GO:0009267 | cellular response to starvation | 16245148 |
Tgene | ALB | GO:0043066 | negative regulation of apoptotic process | 16153637 |
Tgene | ALB | GO:0051659 | maintenance of mitochondrion location | 16153637 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:100242471/chr4:74279137) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000305046 | ADH1B | chr4 | 100242471 | - | ENST00000295897 | ALB | chr4 | 74279137 | + | 1417 | 86 | 38 | 1072 | 344 |
ENST00000305046 | ADH1B | chr4 | 100242471 | - | ENST00000415165 | ALB | chr4 | 74279137 | + | 1261 | 86 | 38 | 1072 | 344 |
ENST00000305046 | ADH1B | chr4 | 100242471 | - | ENST00000503124 | ALB | chr4 | 74279137 | + | 1227 | 86 | 38 | 1072 | 344 |
ENST00000305046 | ADH1B | chr4 | 100242471 | - | ENST00000509063 | ALB | chr4 | 74279137 | + | 1130 | 86 | 38 | 1057 | 339 |
ENST00000305046 | ADH1B | chr4 | 100242471 | - | ENST00000401494 | ALB | chr4 | 74279137 | + | 1227 | 86 | 38 | 1072 | 344 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000305046 | ENST00000295897 | ADH1B | chr4 | 100242471 | - | ALB | chr4 | 74279137 | + | 0.001435951 | 0.99856406 |
ENST00000305046 | ENST00000415165 | ADH1B | chr4 | 100242471 | - | ALB | chr4 | 74279137 | + | 0.001506765 | 0.9984932 |
ENST00000305046 | ENST00000503124 | ADH1B | chr4 | 100242471 | - | ALB | chr4 | 74279137 | + | 0.001216141 | 0.9987839 |
ENST00000305046 | ENST00000509063 | ADH1B | chr4 | 100242471 | - | ALB | chr4 | 74279137 | + | 0.002062079 | 0.99793786 |
ENST00000305046 | ENST00000401494 | ADH1B | chr4 | 100242471 | - | ALB | chr4 | 74279137 | + | 0.001216141 | 0.9987839 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ADH1B-ALB |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ADH1B | chr4 | 100242471 | ALB | chr4 | 74279137 | 86 | 16 | GREDRNDMSTAGKADLAKYICENQDS |
Top |
Potential FusionNeoAntigen Information of ADH1B-ALB in HLA I |
![]() |
ADH1B-ALB_100242471_74279137.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 86 | HLA-C05:09 | KADLAKYI | 1 | 0.8464 | 12 | 20 |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 86 | HLA-C08:15 | KADLAKYI | 0.9999 | 0.9341 | 12 | 20 |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 86 | HLA-B73:01 | DRNDMSTAGKA | 0.9972 | 0.9043 | 3 | 14 |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 86 | HLA-C04:03 | KADLAKYI | 1 | 0.6647 | 12 | 20 |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 86 | HLA-C05:01 | KADLAKYI | 1 | 0.8464 | 12 | 20 |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 86 | HLA-C08:02 | KADLAKYI | 0.9999 | 0.9341 | 12 | 20 |
Top |
Potential FusionNeoAntigen Information of ADH1B-ALB in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ADH1B-ALB |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1265 | DMSTAGKADLAKYI | ADH1B | ALB | chr4 | 100242471 | chr4 | 74279137 | 86 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ADH1B-ALB |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1265 | DMSTAGKADLAKYI | -6.49513 | -7.53823 |
HLA-B14:02 | 3BVN | 1265 | DMSTAGKADLAKYI | -5.42079 | -5.53259 |
HLA-B52:01 | 3W39 | 1265 | DMSTAGKADLAKYI | -5.86639 | -6.90949 |
HLA-B52:01 | 3W39 | 1265 | DMSTAGKADLAKYI | -5.61291 | -5.72471 |
HLA-A11:01 | 4UQ2 | 1265 | DMSTAGKADLAKYI | -3.46825 | -4.51135 |
HLA-A24:02 | 5HGA | 1265 | DMSTAGKADLAKYI | -6.23799 | -6.34979 |
HLA-A24:02 | 5HGA | 1265 | DMSTAGKADLAKYI | -3.82387 | -4.86697 |
HLA-B27:05 | 6PYJ | 1265 | DMSTAGKADLAKYI | -5.76358 | -6.80668 |
HLA-B44:05 | 3DX8 | 1265 | DMSTAGKADLAKYI | -4.7768 | -4.8886 |
HLA-B44:05 | 3DX8 | 1265 | DMSTAGKADLAKYI | -3.57735 | -4.62045 |
HLA-A02:01 | 6TDR | 1265 | DMSTAGKADLAKYI | -3.77444 | -3.88624 |
Top |
Vaccine Design for the FusionNeoAntigens of ADH1B-ALB |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 12 | 20 | KADLAKYI | AAAGCGGACCTTGCCAAGTATATC |
ADH1B-ALB | chr4 | 100242471 | chr4 | 74279137 | 3 | 14 | DRNDMSTAGKA | GACAGAAACGACATGAGCACAGCAGGAAAAGCG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ADH1B-ALB |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Non-Cancer | ADH1B-ALB | chr4 | 100242471 | ENST00000305046 | chr4 | 74279137 | ENST00000295897 | TCGA-DD-A11C-11A |
Top |
Potential target of CAR-T therapy development for ADH1B-ALB |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ADH1B-ALB |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ADH1B-ALB |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |