Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EGFR-GYG1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EGFR-GYG1
	FusionPDB ID: 25459
	FusionGDB2.0 ID: 25459
		Hgene	Tgene
	Gene symbol	EGFR	GYG1
	Gene ID	1956	2992
	Gene name	epidermal growth factor receptor	glycogenin 1
	Synonyms	ERBB\|ERBB1\|HER1\|NISBD2\|PIG61\|mENA	GSD15\|GYG
	Cytomap	7p11.2	3q24
	Type of gene	protein-coding	protein-coding
	Description	epidermal growth factor receptoravian erythroblastic leukemia viral (v-erb-b) oncogene homologcell growth inhibiting protein 40cell proliferation-inducing protein 61epidermal growth factor receptor tyrosine kinase domainerb-b2 receptor tyrosine kinas	glycogenin-1GN-1glycogenin glucosyltransferase
	Modification date	20200329	20200313
	UniProtAcc	P00533 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase binding ligands of the EGF family and activating several signaling cascades to convert extracellular cues into appropriate cellular responses (PubMed:2790960, PubMed:10805725, PubMed:27153536). Known ligands include EGF, TGFA/TGF-alpha, AREG, epigen/EPGN, BTC/betacellulin, epiregulin/EREG and HBEGF/heparin-binding EGF (PubMed:2790960, PubMed:7679104, PubMed:8144591, PubMed:9419975, PubMed:15611079, PubMed:12297049, PubMed:27153536, PubMed:20837704, PubMed:17909029). Ligand binding triggers receptor homo- and/or heterodimerization and autophosphorylation on key cytoplasmic residues. The phosphorylated receptor recruits adapter proteins like GRB2 which in turn activates complex downstream signaling cascades. Activates at least 4 major downstream signaling cascades including the RAS-RAF-MEK-ERK, PI3 kinase-AKT, PLCgamma-PKC and STATs modules (PubMed:27153536). May also activate the NF-kappa-B signaling cascade (PubMed:11116146). Also directly phosphorylates other proteins like RGS16, activating its GTPase activity and probably coupling the EGF receptor signaling to the G protein-coupled receptor signaling (PubMed:11602604). Also phosphorylates MUC1 and increases its interaction with SRC and CTNNB1/beta-catenin (PubMed:11483589). Positively regulates cell migration via interaction with CCDC88A/GIV which retains EGFR at the cell membrane following ligand stimulation, promoting EGFR signaling which triggers cell migration (PubMed:20462955). Plays a role in enhancing learning and memory performance (By similarity). {ECO:0000250\|UniProtKB:Q01279, ECO:0000269\|PubMed:10805725, ECO:0000269\|PubMed:11116146, ECO:0000269\|PubMed:11483589, ECO:0000269\|PubMed:11602604, ECO:0000269\|PubMed:12297049, ECO:0000269\|PubMed:12297050, ECO:0000269\|PubMed:12620237, ECO:0000269\|PubMed:12873986, ECO:0000269\|PubMed:15374980, ECO:0000269\|PubMed:15590694, ECO:0000269\|PubMed:15611079, ECO:0000269\|PubMed:17115032, ECO:0000269\|PubMed:17909029, ECO:0000269\|PubMed:19560417, ECO:0000269\|PubMed:20462955, ECO:0000269\|PubMed:20837704, ECO:0000269\|PubMed:21258366, ECO:0000269\|PubMed:27153536, ECO:0000269\|PubMed:2790960, ECO:0000269\|PubMed:7679104, ECO:0000269\|PubMed:8144591, ECO:0000269\|PubMed:9419975}.; FUNCTION: Isoform 2 may act as an antagonist of EGF action.; FUNCTION: (Microbial infection) Acts as a receptor for hepatitis C virus (HCV) in hepatocytes and facilitates its cell entry. Mediates HCV entry by promoting the formation of the CD81-CLDN1 receptor complexes that are essential for HCV entry and by enhancing membrane fusion of cells expressing HCV envelope glycoproteins. {ECO:0000269\|PubMed:21516087}.	P46976 Main function of 5'-partner protein: FUNCTION: Self-glucosylates, via an inter-subunit mechanism, to form an oligosaccharide primer that serves as substrate for glycogen synthase. {ECO:0000269\|PubMed:22160680, ECO:0000269\|PubMed:30356213}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000463948, ENST00000275493, ENST00000342916, ENST00000344576, ENST00000420316, ENST00000442591, ENST00000455089, ENST00000454757,	ENST00000296048, ENST00000345003, ENST00000483267, ENST00000484197, ENST00000479119,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	41 X 25 X 14=14350	9 X 7 X 3=189
	# samples	53	11
	** MAII score	log2(53/14350*10)=-4.75891456699985 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/189*10)=-0.780882710696413 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EGFR [Title/Abstract] AND GYG1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EGFR [Title/Abstract] AND GYG1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EGFR(55087058)-GYG1(148711929), # samples:2
Anticipated loss of major functional domain due to fusion event.	EGFR-GYG1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EGFR-GYG1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EGFR-GYG1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EGFR-GYG1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	EGFR	GO:0001934	positive regulation of protein phosphorylation	20551055
Hgene	EGFR	GO:0007165	signal transduction	10572067
Hgene	EGFR	GO:0007166	cell surface receptor signaling pathway	7736574
Hgene	EGFR	GO:0007173	epidermal growth factor receptor signaling pathway	7736574\|12435727
Hgene	EGFR	GO:0008283	cell proliferation	17115032
Hgene	EGFR	GO:0008284	positive regulation of cell proliferation	7736574
Hgene	EGFR	GO:0010750	positive regulation of nitric oxide mediated signal transduction	12828935
Hgene	EGFR	GO:0018108	peptidyl-tyrosine phosphorylation	22732145
Hgene	EGFR	GO:0030307	positive regulation of cell growth	15467833
Hgene	EGFR	GO:0042177	negative regulation of protein catabolic process	17115032
Hgene	EGFR	GO:0042327	positive regulation of phosphorylation	15082764
Hgene	EGFR	GO:0043406	positive regulation of MAP kinase activity	10572067
Hgene	EGFR	GO:0045739	positive regulation of DNA repair	17115032
Hgene	EGFR	GO:0045740	positive regulation of DNA replication	17115032
Hgene	EGFR	GO:0045944	positive regulation of transcription by RNA polymerase II	20551055
Hgene	EGFR	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Hgene	EGFR	GO:0050999	regulation of nitric-oxide synthase activity	12828935
Hgene	EGFR	GO:0070141	response to UV-A	18483258
Hgene	EGFR	GO:0070374	positive regulation of ERK1 and ERK2 cascade	20551055
Hgene	EGFR	GO:0071392	cellular response to estradiol stimulus	20551055
Hgene	EGFR	GO:1900020	positive regulation of protein kinase C activity	22732145
Hgene	EGFR	GO:1903078	positive regulation of protein localization to plasma membrane	22732145

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:55087058/chr3:148711929)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EGFR (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across GYG1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000455089	EGFR	chr7	55087058	+	ENST00000345003	GYG1	chr3	148711929	+	2090	345	257	1390	377
ENST00000455089	EGFR	chr7	55087058	+	ENST00000296048	GYG1	chr3	148711929	+	2039	345	257	1339	360
ENST00000455089	EGFR	chr7	55087058	+	ENST00000483267	GYG1	chr3	148711929	+	1010	345	257	919	220
ENST00000455089	EGFR	chr7	55087058	+	ENST00000484197	GYG1	chr3	148711929	+	1818	345	257	1177	306
ENST00000342916	EGFR	chr7	55087058	+	ENST00000345003	GYG1	chr3	148711929	+	2079	334	246	1379	377
ENST00000342916	EGFR	chr7	55087058	+	ENST00000296048	GYG1	chr3	148711929	+	2028	334	246	1328	360
ENST00000342916	EGFR	chr7	55087058	+	ENST00000483267	GYG1	chr3	148711929	+	999	334	246	908	220
ENST00000342916	EGFR	chr7	55087058	+	ENST00000484197	GYG1	chr3	148711929	+	1807	334	246	1166	306
ENST00000344576	EGFR	chr7	55087058	+	ENST00000345003	GYG1	chr3	148711929	+	2078	333	245	1378	377
ENST00000344576	EGFR	chr7	55087058	+	ENST00000296048	GYG1	chr3	148711929	+	2027	333	245	1327	360
ENST00000344576	EGFR	chr7	55087058	+	ENST00000483267	GYG1	chr3	148711929	+	998	333	245	907	220
ENST00000344576	EGFR	chr7	55087058	+	ENST00000484197	GYG1	chr3	148711929	+	1806	333	245	1165	306
ENST00000420316	EGFR	chr7	55087058	+	ENST00000345003	GYG1	chr3	148711929	+	2077	332	244	1377	377
ENST00000420316	EGFR	chr7	55087058	+	ENST00000296048	GYG1	chr3	148711929	+	2026	332	244	1326	360
ENST00000420316	EGFR	chr7	55087058	+	ENST00000483267	GYG1	chr3	148711929	+	997	332	244	906	220
ENST00000420316	EGFR	chr7	55087058	+	ENST00000484197	GYG1	chr3	148711929	+	1805	332	244	1164	306
ENST00000275493	EGFR	chr7	55087058	+	ENST00000345003	GYG1	chr3	148711929	+	2010	265	177	1310	377
ENST00000275493	EGFR	chr7	55087058	+	ENST00000296048	GYG1	chr3	148711929	+	1959	265	177	1259	360
ENST00000275493	EGFR	chr7	55087058	+	ENST00000483267	GYG1	chr3	148711929	+	930	265	177	839	220
ENST00000275493	EGFR	chr7	55087058	+	ENST00000484197	GYG1	chr3	148711929	+	1738	265	177	1097	306
ENST00000442591	EGFR	chr7	55087058	+	ENST00000345003	GYG1	chr3	148711929	+	1993	248	160	1293	377
ENST00000442591	EGFR	chr7	55087058	+	ENST00000296048	GYG1	chr3	148711929	+	1942	248	160	1242	360
ENST00000442591	EGFR	chr7	55087058	+	ENST00000483267	GYG1	chr3	148711929	+	913	248	160	822	220
ENST00000442591	EGFR	chr7	55087058	+	ENST00000484197	GYG1	chr3	148711929	+	1721	248	160	1080	306

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000455089	ENST00000345003	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000827402	0.9991725
ENST00000455089	ENST00000296048	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.0006716	0.9993284
ENST00000455089	ENST00000483267	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002171182	0.9978288
ENST00000455089	ENST00000484197	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002775402	0.99722457
ENST00000342916	ENST00000345003	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.00084733	0.99915266
ENST00000342916	ENST00000296048	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000676675	0.99932337
ENST00000342916	ENST00000483267	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002251787	0.9977482
ENST00000342916	ENST00000484197	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002908195	0.99709177
ENST00000344576	ENST00000345003	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.00084415	0.9991559
ENST00000344576	ENST00000296048	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000673178	0.9993268
ENST00000344576	ENST00000483267	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002230314	0.9977697
ENST00000344576	ENST00000484197	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002897437	0.99710256
ENST00000420316	ENST00000345003	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000843698	0.99915636
ENST00000420316	ENST00000296048	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000663794	0.9993362
ENST00000420316	ENST00000483267	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002211811	0.9977882
ENST00000420316	ENST00000484197	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002869505	0.9971306
ENST00000275493	ENST00000345003	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000750827	0.99924916
ENST00000275493	ENST00000296048	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000590469	0.99940956
ENST00000275493	ENST00000483267	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.001582202	0.99841774
ENST00000275493	ENST00000484197	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002659416	0.9973406
ENST00000442591	ENST00000345003	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000713567	0.9992865
ENST00000442591	ENST00000296048	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.000563597	0.99943644
ENST00000442591	ENST00000483267	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.001504915	0.9984951
ENST00000442591	ENST00000484197	EGFR	chr7	55087058	+	GYG1	chr3	148711929	+	0.002573758	0.9974262

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EGFR-GYG1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EGFR	chr7	55087058	GYG1	chr3	148711929	248	29	ALCPASRALEEKKDQAFVTLTTNDAY
EGFR	chr7	55087058	GYG1	chr3	148711929	265	29	ALCPASRALEEKKDQAFVTLTTNDAY
EGFR	chr7	55087058	GYG1	chr3	148711929	332	29	ALCPASRALEEKKDQAFVTLTTNDAY
EGFR	chr7	55087058	GYG1	chr3	148711929	333	29	ALCPASRALEEKKDQAFVTLTTNDAY
EGFR	chr7	55087058	GYG1	chr3	148711929	334	29	ALCPASRALEEKKDQAFVTLTTNDAY
EGFR	chr7	55087058	GYG1	chr3	148711929	345	29	ALCPASRALEEKKDQAFVTLTTNDAY

Top

Potential FusionNeoAntigen Information of EGFR-GYG1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EGFR-GYG1_55087058_148711929.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B45:01	EEKKDQAFV	0.9944	0.5663	9	18
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:01	KKDQAFVTL	0.9903	0.8032	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:13	KKDQAFVTL	0.9792	0.8468	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B38:01	KKDQAFVTL	0.9749	0.917	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B38:02	KKDQAFVTL	0.9717	0.916	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:03	LEEKKDQAF	0.953	0.681	8	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B15:10	KKDQAFVTL	0.6691	0.5009	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B15:03	KKDQAFVTL	0.4889	0.7364	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B15:37	KKDQAFVTL	0.3837	0.5255	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B47:01	KKDQAFVTL	0.062	0.5578	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:03	ALEEKKDQAF	0.5956	0.8426	7	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C04:10	KKDQAFVTL	0.9992	0.8762	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C04:07	KKDQAFVTL	0.9991	0.8713	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C08:15	KKDQAFVTL	0.9984	0.967	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:09	KKDQAFVTL	0.992	0.6052	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C07:95	KKDQAFVTL	0.9913	0.5457	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:12	KKDQAFVTL	0.9891	0.8117	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C07:29	KKDQAFVTL	0.9804	0.8744	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C07:13	KKDQAFVTL	0.9791	0.8543	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:05	KKDQAFVTL	0.9591	0.7863	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C07:19	KKDQAFVTL	0.848	0.6514	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:08	KKDQAFVTL	0.6233	0.7297	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B14:03	KKDQAFVTL	0.5946	0.7495	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C04:14	KKDQAFVTL	0.472	0.8845	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:08	LEEKKDQAF	0.2993	0.5008	8	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C04:01	KKDQAFVTL	0.9991	0.8713	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C18:01	KKDQAFVTL	0.9986	0.8979	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C08:02	KKDQAFVTL	0.9984	0.967	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:02	KKDQAFVTL	0.9925	0.846	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:31	KKDQAFVTL	0.9875	0.8048	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B38:05	KKDQAFVTL	0.9749	0.917	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B18:04	LEEKKDQAF	0.9686	0.5245	8	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:07	LEEKKDQAF	0.953	0.681	8	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:26	LEEKKDQAF	0.953	0.681	8	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:13	LEEKKDQAF	0.953	0.681	8	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C07:17	KKDQAFVTL	0.8821	0.9238	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C06:06	KKDQAFVTL	0.8198	0.9823	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B18:11	LEEKKDQAF	0.7821	0.5456	8	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C07:04	KKDQAFVTL	0.7289	0.9008	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C04:04	KKDQAFVTL	0.7025	0.8542	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-C03:67	KKDQAFVTL	0.6744	0.9675	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B39:11	KKDQAFVTL	0.6313	0.6495	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B15:09	KKDQAFVTL	0.5926	0.5612	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B48:02	KKDQAFVTL	0.5512	0.8312	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B07:13	KKDQAFVTL	0.0155	0.7585	11	20
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:26	ALEEKKDQAF	0.5956	0.8426	7	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:07	ALEEKKDQAF	0.5956	0.8426	7	17
EGFR-GYG1	chr7	55087058	chr3	148711929	265	HLA-B44:13	ALEEKKDQAF	0.5956	0.8426	7	17

Top

Potential FusionNeoAntigen Information of EGFR-GYG1 in HLA II

EGFR-GYG1_55087058_148711929.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0401	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0405	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0407	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0419	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0424	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0429	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0430	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0431	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0433	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0434	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0435	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0438	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0443	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0445	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0447	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0448	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0451	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0454	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0457	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0461	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0462	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0463	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0464	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0469	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0474	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0475	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0476	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0477	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0480	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0482	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0483	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0484	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0486	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0487	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-0489	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-1001	KKDQAFVTLTTNDAY	11	26
EGFR-GYG1	chr7	55087058	chr3	148711929	265	DRB1-1003	KKDQAFVTLTTNDAY	11	26

Top

Fusion breakpoint peptide structures of EGFR-GYG1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7693	RALEEKKDQAFVTL	EGFR	GYG1	chr7	55087058	chr3	148711929	265

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EGFR-GYG1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7693	RALEEKKDQAFVTL	-7.15543	-7.26883
HLA-B14:02	3BVN	7693	RALEEKKDQAFVTL	-4.77435	-5.80965
HLA-B52:01	3W39	7693	RALEEKKDQAFVTL	-6.80875	-6.92215
HLA-B52:01	3W39	7693	RALEEKKDQAFVTL	-4.20386	-5.23916
HLA-A11:01	4UQ2	7693	RALEEKKDQAFVTL	-7.5194	-8.5547
HLA-A11:01	4UQ2	7693	RALEEKKDQAFVTL	-6.9601	-7.0735
HLA-A24:02	5HGA	7693	RALEEKKDQAFVTL	-7.52403	-7.63743
HLA-A24:02	5HGA	7693	RALEEKKDQAFVTL	-5.82433	-6.85963
HLA-B27:05	6PYJ	7693	RALEEKKDQAFVTL	-3.28285	-4.31815
HLA-B44:05	3DX8	7693	RALEEKKDQAFVTL	-5.91172	-6.94702
HLA-B44:05	3DX8	7693	RALEEKKDQAFVTL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of EGFR-GYG1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EGFR-GYG1	chr7	55087058	chr3	148711929	11	20	KKDQAFVTL	AGAAAGATCAGGCCTTTGTGACACTAA
EGFR-GYG1	chr7	55087058	chr3	148711929	7	17	ALEEKKDQAF	CTCTGGAGGAAAAGAAAGATCAGGCCTTTG
EGFR-GYG1	chr7	55087058	chr3	148711929	8	17	LEEKKDQAF	TGGAGGAAAAGAAAGATCAGGCCTTTG
EGFR-GYG1	chr7	55087058	chr3	148711929	9	18	EEKKDQAFV	AGGAAAAGAAAGATCAGGCCTTTGTGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
EGFR-GYG1	chr7	55087058	chr3	148711929	11	26	KKDQAFVTLTTNDAY	AGAAAGATCAGGCCTTTGTGACACTAACCACAAACGATGCCTACG

Top

Information of the samples that have these potential fusion neoantigens of EGFR-GYG1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	EGFR-GYG1	chr7	55087058	ENST00000275493	chr3	148711929	ENST00000296048	TCGA-FD-A3B7-01A

Top

Potential target of CAR-T therapy development for EGFR-GYG1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EGFR-GYG1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EGFR-GYG1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)