![]() |
|||||||
|
Fusion Protein:EHBP1-BCL11A |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: EHBP1-BCL11A | FusionPDB ID: 25525 | FusionGDB2.0 ID: 25525 | Hgene | Tgene | Gene symbol | EHBP1 | BCL11A | Gene ID | 23301 | 53335 |
Gene name | EH domain binding protein 1 | BAF chromatin remodeling complex subunit BCL11A | |
Synonyms | HPC12|NACSIN | BCL11A-L|BCL11A-S|BCL11A-XL|BCL11a-M|CTIP1|DILOS|EVI9|HBFQTL5|ZNF856 | |
Cytomap | 2p15 | 2p16.1 | |
Type of gene | protein-coding | protein-coding | |
Description | EH domain-binding protein 1NPF calponin-like proteintestis tissue sperm-binding protein Li 50e | B-cell lymphoma/leukemia 11AB cell CLL/lymphoma 11AB-cell CLL/lymphoma 11A (zinc finger protein) isoform 2BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) isoform 1BCL11A, BAF complex componentC2H2-type zinc finger proteinCOUP-TF-interacting pro | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q8N3D4 Main function of 5'-partner protein: FUNCTION: May act as Rab effector protein and play a role in vesicle trafficking. {ECO:0000305|PubMed:27552051}. | Q9H165 Main function of 5'-partner protein: FUNCTION: Transcription factor associated with the BAF SWI/SNF chromatin remodeling complex (By similarity). Repressor of fetal hemoglobin (HbF) level (PubMed:26375765). Involved in brain development (PubMed:27453576). May play a role in hematopoiesis. Essential factor in lymphopoiesis required for B-cell formation in fetal liver. May function as a modulator of the transcriptional repression activity of ARP1 (By similarity). {ECO:0000250|UniProtKB:Q9QYE3, ECO:0000303|PubMed:26375765, ECO:0000303|PubMed:27453576}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000263991, ENST00000354487, ENST00000405015, ENST00000405289, ENST00000431489, ENST00000496857, | ENST00000335712, ENST00000358510, ENST00000477659, ENST00000356842, ENST00000359629, ENST00000538214, ENST00000537768, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 8 X 12 X 8=768 | 10 X 9 X 3=270 |
# samples | 20 | 9 | |
** MAII score | log2(20/768*10)=-1.94110631094643 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(9/270*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: EHBP1 [Title/Abstract] AND BCL11A [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: EHBP1 [Title/Abstract] AND BCL11A [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | EHBP1(63101667)-BCL11A(60679801), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | EHBP1-BCL11A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EHBP1-BCL11A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EHBP1-BCL11A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EHBP1-BCL11A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EHBP1-BCL11A seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. EHBP1-BCL11A seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. EHBP1-BCL11A seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | BCL11A | GO:0000122 | negative regulation of transcription by RNA polymerase II | 19153051 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:63101667/chr2:60679801) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000405015 | EHBP1 | chr2 | 63101667 | + | ENST00000537768 | BCL11A | chr2 | 60679801 | - | 1880 | 1713 | 519 | 1814 | 431 |
ENST00000431489 | EHBP1 | chr2 | 63101667 | + | ENST00000537768 | BCL11A | chr2 | 60679801 | - | 1958 | 1791 | 597 | 1892 | 431 |
ENST00000354487 | EHBP1 | chr2 | 63101667 | + | ENST00000537768 | BCL11A | chr2 | 60679801 | - | 1834 | 1667 | 473 | 1768 | 431 |
ENST00000263991 | EHBP1 | chr2 | 63101667 | + | ENST00000537768 | BCL11A | chr2 | 60679801 | - | 1939 | 1772 | 473 | 1873 | 466 |
ENST00000405289 | EHBP1 | chr2 | 63101667 | + | ENST00000537768 | BCL11A | chr2 | 60679801 | - | 1352 | 1185 | 0 | 1286 | 428 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000405015 | ENST00000537768 | EHBP1 | chr2 | 63101667 | + | BCL11A | chr2 | 60679801 | - | 0.00142861 | 0.9985714 |
ENST00000431489 | ENST00000537768 | EHBP1 | chr2 | 63101667 | + | BCL11A | chr2 | 60679801 | - | 0.001398618 | 0.9986014 |
ENST00000354487 | ENST00000537768 | EHBP1 | chr2 | 63101667 | + | BCL11A | chr2 | 60679801 | - | 0.001373942 | 0.9986261 |
ENST00000263991 | ENST00000537768 | EHBP1 | chr2 | 63101667 | + | BCL11A | chr2 | 60679801 | - | 0.001268179 | 0.9987318 |
ENST00000405289 | ENST00000537768 | EHBP1 | chr2 | 63101667 | + | BCL11A | chr2 | 60679801 | - | 0.002551905 | 0.9974481 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for EHBP1-BCL11A |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
EHBP1 | chr2 | 63101667 | BCL11A | chr2 | 60679801 | 1185 | 391 | LNENTVSAGKDLSTSPKVLHTPPFGV |
EHBP1 | chr2 | 63101667 | BCL11A | chr2 | 60679801 | 1667 | 394 | LNENTVSAGKDLSTSPKVLHTPPFGV |
EHBP1 | chr2 | 63101667 | BCL11A | chr2 | 60679801 | 1713 | 394 | LNENTVSAGKDLSTSPKVLHTPPFGV |
EHBP1 | chr2 | 63101667 | BCL11A | chr2 | 60679801 | 1772 | 429 | LNENTVSAGKDLSTSPKVLHTPPFGV |
EHBP1 | chr2 | 63101667 | BCL11A | chr2 | 60679801 | 1791 | 394 | LNENTVSAGKDLSTSPKVLHTPPFGV |
Top |
Potential FusionNeoAntigen Information of EHBP1-BCL11A in HLA I |
![]() |
EHBP1-BCL11A_63101667_60679801.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
EHBP1-BCL11A | chr2 | 63101667 | chr2 | 60679801 | 1772 | HLA-A30:08 | STSPKVLHT | 0.858 | 0.6187 | 12 | 21 |
EHBP1-BCL11A | chr2 | 63101667 | chr2 | 60679801 | 1772 | HLA-C16:01 | LSTSPKVL | 0.9424 | 0.9862 | 11 | 19 |
EHBP1-BCL11A | chr2 | 63101667 | chr2 | 60679801 | 1772 | HLA-C15:02 | STSPKVLHT | 0.9845 | 0.755 | 12 | 21 |
EHBP1-BCL11A | chr2 | 63101667 | chr2 | 60679801 | 1772 | HLA-B08:12 | DLSTSPKVL | 0.5312 | 0.6104 | 10 | 19 |
Top |
Potential FusionNeoAntigen Information of EHBP1-BCL11A in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of EHBP1-BCL11A |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8389 | SAGKDLSTSPKVLH | EHBP1 | BCL11A | chr2 | 63101667 | chr2 | 60679801 | 1772 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EHBP1-BCL11A |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8389 | SAGKDLSTSPKVLH | -6.66017 | -6.77357 |
HLA-B14:02 | 3BVN | 8389 | SAGKDLSTSPKVLH | -3.48242 | -4.51772 |
HLA-B27:09 | 3CZF | 8389 | SAGKDLSTSPKVLH | 10000.1 | 10000 |
HLA-B52:01 | 3W39 | 8389 | SAGKDLSTSPKVLH | -5.06127 | -5.17467 |
HLA-B52:01 | 3W39 | 8389 | SAGKDLSTSPKVLH | -4.23673 | -5.27203 |
HLA-B18:01 | 4JQV | 8389 | SAGKDLSTSPKVLH | -3.70535 | -3.81875 |
HLA-A11:01 | 4UQ2 | 8389 | SAGKDLSTSPKVLH | -8.9083 | -9.0217 |
HLA-A11:01 | 4UQ2 | 8389 | SAGKDLSTSPKVLH | -5.86986 | -6.90516 |
HLA-A24:02 | 5HGA | 8389 | SAGKDLSTSPKVLH | -6.45287 | -6.56627 |
HLA-A24:02 | 5HGA | 8389 | SAGKDLSTSPKVLH | -6.01305 | -7.04835 |
HLA-B27:05 | 6PYJ | 8389 | SAGKDLSTSPKVLH | -4.82238 | -5.85768 |
HLA-B27:05 | 6PYJ | 8389 | SAGKDLSTSPKVLH | -4.78695 | -4.90035 |
HLA-B27:03 | 6PZ5 | 8389 | SAGKDLSTSPKVLH | -5.33736 | -5.45076 |
HLA-B27:03 | 6PZ5 | 8389 | SAGKDLSTSPKVLH | -2.16924 | -3.20454 |
HLA-B44:05 | 3DX8 | 8389 | SAGKDLSTSPKVLH | -5.3498 | -5.4632 |
HLA-B44:05 | 3DX8 | 8389 | SAGKDLSTSPKVLH | -3.28888 | -4.32418 |
HLA-A02:01 | 6TDR | 8389 | SAGKDLSTSPKVLH | -2.20851 | -3.24381 |
Top |
Vaccine Design for the FusionNeoAntigens of EHBP1-BCL11A |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
EHBP1-BCL11A | chr2 | 63101667 | chr2 | 60679801 | 10 | 19 | DLSTSPKVL | TCTCCTAAGGTTCTTCACACACCCCCA |
EHBP1-BCL11A | chr2 | 63101667 | chr2 | 60679801 | 11 | 19 | LSTSPKVL | CCTAAGGTTCTTCACACACCCCCA |
EHBP1-BCL11A | chr2 | 63101667 | chr2 | 60679801 | 12 | 21 | STSPKVLHT | AAGGTTCTTCACACACCCCCATTCGGC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of EHBP1-BCL11A |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | EHBP1-BCL11A | chr2 | 63101667 | ENST00000263991 | chr2 | 60679801 | ENST00000537768 | TCGA-D8-A147-01A |
Top |
Potential target of CAR-T therapy development for EHBP1-BCL11A |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to EHBP1-BCL11A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to EHBP1-BCL11A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |