![]() |
|||||||
|
Fusion Protein:EIF2AK3-MBD2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: EIF2AK3-MBD2 | FusionPDB ID: 25669 | FusionGDB2.0 ID: 25669 | Hgene | Tgene | Gene symbol | EIF2AK3 | MBD2 | Gene ID | 9451 | 64174 |
Gene name | eukaryotic translation initiation factor 2 alpha kinase 3 | dipeptidase 2 | |
Synonyms | PEK|PERK|WRS | MBD2 | |
Cytomap | 2p11.2 | 16q22.1 | |
Type of gene | protein-coding | protein-coding | |
Description | eukaryotic translation initiation factor 2-alpha kinase 3PRKR-like endoplasmic reticulum kinasepancreatic EIF2-alpha kinasetruncated eukaryotic translation initiation factor 2 alpha kinase 3 | dipeptidase 2 | |
Modification date | 20200320 | 20200313 | |
UniProtAcc | Q9NZJ5 Main function of 5'-partner protein: FUNCTION: Metabolic-stress sensing protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (EIF2S1/eIF-2-alpha) in response to various stress conditions. Key activator of the integrated stress response (ISR) required for adaptation to various stress, such as unfolded protein response (UPR) and low amino acid availability. EIF2S1/eIF-2-alpha phosphorylation in response to stress converts EIF2S1/eIF-2-alpha in a global protein synthesis inhibitor, leading to a global attenuation of cap-dependent translation, while concomitantly initiating the preferential translation of ISR-specific mRNAs, such as the transcriptional activator ATF4, and hence allowing ATF4-mediated reprogramming. Serves as a critical effector of unfolded protein response (UPR)-induced G1 growth arrest due to the loss of cyclin-D1 (CCND1). Involved in control of mitochondrial morphology and function. {ECO:0000250|UniProtKB:Q9Z2B5}. | Q9UBB5 Main function of 5'-partner protein: FUNCTION: Binds CpG islands in promoters where the DNA is methylated at position 5 of cytosine within CpG dinucleotides. Binds hemimethylated DNA as well. Recruits histone deacetylases and DNA methyltransferases. Acts as transcriptional repressor and plays a role in gene silencing. Functions as a scaffold protein, targeting GATAD2A and GATAD2B to chromatin to promote repression. May enhance the activation of some unmethylated cAMP-responsive promoters. {ECO:0000269|PubMed:10471499, ECO:0000269|PubMed:10947852, ECO:0000269|PubMed:12665568, ECO:0000269|PubMed:16415179, ECO:0000269|PubMed:24307175, ECO:0000269|PubMed:9774669}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000303236, ENST00000419748, ENST00000470706, | ENST00000398398, ENST00000579025, ENST00000583046, ENST00000256429, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 7 X 4=168 | 13 X 7 X 7=637 |
# samples | 7 | 15 | |
** MAII score | log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(15/637*10)=-2.08633087176042 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: EIF2AK3 [Title/Abstract] AND MBD2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: EIF2AK3 [Title/Abstract] AND MBD2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | EIF2AK3(88913241)-MBD2(51715381), # samples:1 EIF2AK3(88913242)-MBD2(51715381), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | EIF2AK3-MBD2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EIF2AK3-MBD2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EIF2AK3-MBD2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EIF2AK3-MBD2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | EIF2AK3 | GO:0006983 | ER overload response | 10677345|11907036 |
Hgene | EIF2AK3 | GO:0030968 | endoplasmic reticulum unfolded protein response | 10677345|11907036|22169477 |
Hgene | EIF2AK3 | GO:0046777 | protein autophosphorylation | 10026192|11907036 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:88913241/chr18:51715381) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000303236 | EIF2AK3 | chr2 | 88913241 | - | ENST00000256429 | MBD2 | chr18 | 51715381 | - | 3889 | 740 | 227 | 1273 | 348 |
ENST00000303236 | EIF2AK3 | chr2 | 88913242 | - | ENST00000256429 | MBD2 | chr18 | 51715381 | - | 3889 | 740 | 227 | 1273 | 348 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000303236 | ENST00000256429 | EIF2AK3 | chr2 | 88913241 | - | MBD2 | chr18 | 51715381 | - | 0.000276105 | 0.99972385 |
ENST00000303236 | ENST00000256429 | EIF2AK3 | chr2 | 88913242 | - | MBD2 | chr18 | 51715381 | - | 0.000276105 | 0.99972385 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for EIF2AK3-MBD2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
EIF2AK3 | chr2 | 88913241 | MBD2 | chr18 | 51715381 | 740 | 171 | SGSLVSSSLSKPEGKPDLNTTLPIRQ |
EIF2AK3 | chr2 | 88913242 | MBD2 | chr18 | 51715381 | 740 | 171 | SGSLVSSSLSKPEGKPDLNTTLPIRQ |
Top |
Potential FusionNeoAntigen Information of EIF2AK3-MBD2 in HLA I |
![]() |
EIF2AK3-MBD2_88913241_51715381.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
EIF2AK3-MBD2 | chr2 | 88913241 | chr18 | 51715381 | 740 | HLA-A30:08 | SSLSKPEGK | 0.9741 | 0.7787 | 6 | 15 |
EIF2AK3-MBD2 | chr2 | 88913241 | chr18 | 51715381 | 740 | HLA-B39:09 | SKPEGKPDL | 0.7083 | 0.6373 | 9 | 18 |
EIF2AK3-MBD2 | chr2 | 88913241 | chr18 | 51715381 | 740 | HLA-A30:01 | SSLSKPEGK | 0.9752 | 0.9102 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of EIF2AK3-MBD2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of EIF2AK3-MBD2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9025 | SSLSKPEGKPDLNT | EIF2AK3 | MBD2 | chr2 | 88913241 | chr18 | 51715381 | 740 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EIF2AK3-MBD2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 9025 | SSLSKPEGKPDLNT | -5.83318 | -5.94658 |
HLA-B14:02 | 3BVN | 9025 | SSLSKPEGKPDLNT | -5.15841 | -6.19371 |
HLA-B52:01 | 3W39 | 9025 | SSLSKPEGKPDLNT | -6.067 | -7.1023 |
HLA-B52:01 | 3W39 | 9025 | SSLSKPEGKPDLNT | -5.89481 | -6.00821 |
HLA-A11:01 | 4UQ2 | 9025 | SSLSKPEGKPDLNT | -6.01993 | -7.05523 |
HLA-A24:02 | 5HGA | 9025 | SSLSKPEGKPDLNT | -6.89332 | -7.00672 |
HLA-A24:02 | 5HGA | 9025 | SSLSKPEGKPDLNT | -2.89208 | -3.92738 |
HLA-B27:05 | 6PYJ | 9025 | SSLSKPEGKPDLNT | -5.0458 | -5.1592 |
HLA-B44:05 | 3DX8 | 9025 | SSLSKPEGKPDLNT | -7.48272 | -7.59612 |
HLA-B44:05 | 3DX8 | 9025 | SSLSKPEGKPDLNT | -4.34114 | -5.37644 |
HLA-A02:01 | 6TDR | 9025 | SSLSKPEGKPDLNT | -7.02112 | -7.13452 |
Top |
Vaccine Design for the FusionNeoAntigens of EIF2AK3-MBD2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
EIF2AK3-MBD2 | chr2 | 88913241 | chr18 | 51715381 | 6 | 15 | SSLSKPEGK | TCCAGCCTTAGCAAACCAGAGGGTAAA |
EIF2AK3-MBD2 | chr2 | 88913241 | chr18 | 51715381 | 9 | 18 | SKPEGKPDL | AGCAAACCAGAGGGTAAACCAGACTTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of EIF2AK3-MBD2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | EIF2AK3-MBD2 | chr2 | 88913241 | ENST00000303236 | chr18 | 51715381 | ENST00000256429 | TCGA-BR-8080 |
Top |
Potential target of CAR-T therapy development for EIF2AK3-MBD2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to EIF2AK3-MBD2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to EIF2AK3-MBD2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |