Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EIF3B-MAD1L1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EIF3B-MAD1L1
	FusionPDB ID: 25784
	FusionGDB2.0 ID: 25784
		Hgene	Tgene
	Gene symbol	EIF3B	MAD1L1
	Gene ID	8662	8379
	Gene name	eukaryotic translation initiation factor 3 subunit B	mitotic arrest deficient 1 like 1
	Synonyms	EIF3-ETA\|EIF3-P110\|EIF3-P116\|EIF3S9\|PRT1	MAD1\|PIG9\|TP53I9\|TXBP181
	Cytomap	7p22.3	7p22.3
	Type of gene	protein-coding	protein-coding
	Description	eukaryotic translation initiation factor 3 subunit Beukaryotic translation initiation factor 3 subunit 9eukaryotic translation initiation factor 3, subunit 9 (eta, 116kD)eukaryotic translation initiation factor 3, subunit 9 eta, 116kDaprt1 homolog	mitotic spindle assembly checkpoint protein MAD1MAD1 mitotic arrest deficient like 1MAD1-like protein 1mitotic arrest deficient 1-like protein 1mitotic checkpoint MAD1 protein homologmitotic-arrest deficient 1, yeast, homolog-like 1tax-binding prote
	Modification date	20200322	20200313
	UniProtAcc	P55884 Main function of 5'-partner protein: FUNCTION: RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:9388245, PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:9388245, PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773). {ECO:0000255\|HAMAP-Rule:MF_03001, ECO:0000269\|PubMed:17581632, ECO:0000269\|PubMed:25849773, ECO:0000269\|PubMed:27462815, ECO:0000269\|PubMed:9388245}.; FUNCTION: (Microbial infection) In case of FCV infection, plays a role in the ribosomal termination-reinitiation event leading to the translation of VP2 (PubMed:18056426). {ECO:0000269\|PubMed:18056426}.	Q9Y6D9 Main function of 5'-partner protein: FUNCTION: Component of the spindle-assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate (PubMed:10049595, PubMed:20133940, PubMed:29162720). Forms a heterotetrameric complex with the closed conformation form of MAD2L1 (C-MAD2) at unattached kinetochores during prometaphase, recruits an open conformation of MAD2L1 (O-MAD2) and promotes the conversion of O-MAD2 to C-MAD2, which ensures mitotic checkpoint signaling (PubMed:29162720). {ECO:0000269\|PubMed:10049595, ECO:0000269\|PubMed:20133940, ECO:0000269\|PubMed:29162720}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000360876, ENST00000397011,	ENST00000486340, ENST00000265854, ENST00000399654, ENST00000402746, ENST00000406869,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 15 X 5=825	23 X 16 X 12=4416
	# samples	16	37
	** MAII score	log2(16/825*10)=-2.36632221424582 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(37/4416*10)=-3.57714299626186 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EIF3B [Title/Abstract] AND MAD1L1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EIF3B [Title/Abstract] AND MAD1L1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EIF3B(2416710)-MAD1L1(2041756), # samples:1 MAD1L1(2054137)-EIF3B(2418324), # samples:1
Anticipated loss of major functional domain due to fusion event.	EIF3B-MAD1L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EIF3B-MAD1L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EIF3B-MAD1L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EIF3B-MAD1L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MAD1L1-EIF3B seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. MAD1L1-EIF3B seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. MAD1L1-EIF3B seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. MAD1L1-EIF3B seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	EIF3B	GO:0006413	translational initiation	8995410\|17581632
Hgene	EIF3B	GO:0006446	regulation of translational initiation	8995410
Hgene	EIF3B	GO:0075522	IRES-dependent viral translational initiation	9573242
Hgene	EIF3B	GO:0075525	viral translational termination-reinitiation	21347434
Tgene	MAD1L1	GO:0007094	mitotic spindle assembly checkpoint	18981471
Tgene	MAD1L1	GO:0090235	regulation of metaphase plate congression	20133940

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:2416710/chr7:2041756)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EIF3B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MAD1L1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000360876	EIF3B	chr7	2416710	+	ENST00000402746	MAD1L1	chr7	2041756	-	3284	2210	32	3007	991
ENST00000360876	EIF3B	chr7	2416710	+	ENST00000399654	MAD1L1	chr7	2041756	-	3284	2210	32	3007	991
ENST00000360876	EIF3B	chr7	2416710	+	ENST00000406869	MAD1L1	chr7	2041756	-	3284	2210	32	3007	991
ENST00000360876	EIF3B	chr7	2416710	+	ENST00000265854	MAD1L1	chr7	2041756	-	3267	2210	32	3007	991
ENST00000397011	EIF3B	chr7	2416710	+	ENST00000402746	MAD1L1	chr7	2041756	-	3268	2194	16	2991	991
ENST00000397011	EIF3B	chr7	2416710	+	ENST00000399654	MAD1L1	chr7	2041756	-	3268	2194	16	2991	991
ENST00000397011	EIF3B	chr7	2416710	+	ENST00000406869	MAD1L1	chr7	2041756	-	3268	2194	16	2991	991
ENST00000397011	EIF3B	chr7	2416710	+	ENST00000265854	MAD1L1	chr7	2041756	-	3251	2194	16	2991	991

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000360876	ENST00000402746	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003460483	0.9965396
ENST00000360876	ENST00000399654	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003460483	0.9965396
ENST00000360876	ENST00000406869	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003460483	0.9965396
ENST00000360876	ENST00000265854	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003476045	0.9965239
ENST00000397011	ENST00000402746	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003553394	0.99644667
ENST00000397011	ENST00000399654	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003553394	0.99644667
ENST00000397011	ENST00000406869	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003553394	0.99644667
ENST00000397011	ENST00000265854	EIF3B	chr7	2416710	+	MAD1L1	chr7	2041756	-	0.003570545	0.9964295

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EIF3B-MAD1L1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EIF3B	chr7	2416710	MAD1L1	chr7	2041756	2194	726	PRPPTLLSQEQIKAQLSQALEELGGQ
EIF3B	chr7	2416710	MAD1L1	chr7	2041756	2210	726	PRPPTLLSQEQIKAQLSQALEELGGQ

Top

Potential FusionNeoAntigen Information of EIF3B-MAD1L1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EIF3B-MAD1L1_2416710_2041756.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B14:01	IKAQLSQAL	0.996	0.9301	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B14:02	IKAQLSQAL	0.996	0.9301	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:01	IKAQLSQAL	0.9948	0.9725	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:24	SQEQIKAQL	0.9939	0.6575	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:24	IKAQLSQAL	0.9934	0.804	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:13	IKAQLSQAL	0.9869	0.9815	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B38:02	IKAQLSQAL	0.9829	0.9898	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:01	SQEQIKAQL	0.9825	0.9214	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B45:01	QEQIKAQLS	0.9812	0.8786	8	17
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:13	SQEQIKAQL	0.938	0.9258	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B13:02	SQEQIKAQL	0.9372	0.604	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:10	IKAQLSQAL	0.9269	0.5321	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B38:02	SQEQIKAQL	0.925	0.9694	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B38:01	SQEQIKAQL	0.9108	0.9644	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B13:01	SQEQIKAQL	0.9051	0.886	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:37	IKAQLSQAL	0.8659	0.6308	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:37	SQEQIKAQL	0.779	0.528	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:10	SQEQIKAQL	0.7583	0.5739	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:18	IKAQLSQAL	0.6981	0.6741	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:03	IKAQLSQAL	0.6432	0.7375	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B48:01	IKAQLSQAL	0.567	0.5006	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B45:01	QEQIKAQLSQA	0.9984	0.9978	8	19
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-C08:15	SQEQIKAQL	0.9996	0.9542	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:09	IKAQLSQAL	0.995	0.9161	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:12	IKAQLSQAL	0.9928	0.9748	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:09	SQEQIKAQL	0.9856	0.7321	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:05	IKAQLSQAL	0.9853	0.9688	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:12	SQEQIKAQL	0.9758	0.9253	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-C07:13	IKAQLSQAL	0.9485	0.9621	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:08	SQEQIKAQL	0.9345	0.8388	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-C07:29	IKAQLSQAL	0.9246	0.9602	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:05	SQEQIKAQL	0.908	0.9092	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B14:03	SQEQIKAQL	0.8718	0.821	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B14:03	IKAQLSQAL	0.6056	0.9347	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:08	IKAQLSQAL	0.5924	0.9262	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-C12:16	IKAQLSQAL	0.2068	0.9783	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B40:04	QEQIKAQL	0.9991	0.7801	8	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B41:03	QEQIKAQL	0.9914	0.6392	8	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B07:13	KAQLSQAL	0.9425	0.8299	12	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-C16:01	KAQLSQAL	0.9248	0.9812	12	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-C08:02	SQEQIKAQL	0.9996	0.9542	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:31	IKAQLSQAL	0.995	0.9732	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:02	IKAQLSQAL	0.9943	0.9818	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:02	SQEQIKAQL	0.9875	0.9269	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:31	SQEQIKAQL	0.9858	0.925	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:11	SQEQIKAQL	0.9403	0.817	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B38:05	SQEQIKAQL	0.9108	0.9644	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:73	SQEQIKAQL	0.8446	0.8859	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B48:02	SQEQIKAQL	0.7966	0.8299	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:30	SQEQIKAQL	0.7727	0.8772	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:09	IKAQLSQAL	0.7438	0.7227	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B48:02	IKAQLSQAL	0.6608	0.9444	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-C03:67	IKAQLSQAL	0.6139	0.9817	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B39:11	IKAQLSQAL	0.6125	0.9102	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:09	SQEQIKAQL	0.5965	0.7151	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:68	IKAQLSQAL	0.3048	0.6483	11	20
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B07:13	SQEQIKAQL	0.281	0.7875	7	16
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	HLA-B15:54	IKAQLSQAL	0.1997	0.809	11	20

Top

Potential FusionNeoAntigen Information of EIF3B-MAD1L1 in HLA II

EIF3B-MAD1L1_2416710_2041756.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-0102	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-0102	QEQIKAQLSQALEEL	8	23
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-0109	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-0115	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-0123	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-0123	QEQIKAQLSQALEEL	8	23
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-1507	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-1523	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-1525	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-1525	QEQIKAQLSQALEEL	8	23
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-1548	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-1615	SQEQIKAQLSQALEE	7	22
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB1-1615	QEQIKAQLSQALEEL	8	23
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB4-0101	PPTLLSQEQIKAQLS	2	17
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB4-0103	PPTLLSQEQIKAQLS	2	17
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB4-0104	PPTLLSQEQIKAQLS	2	17
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB4-0106	PPTLLSQEQIKAQLS	2	17
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB4-0107	PPTLLSQEQIKAQLS	2	17
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2210	DRB4-0108	PPTLLSQEQIKAQLS	2	17

Top

Fusion breakpoint peptide structures of EIF3B-MAD1L1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5654	LSQEQIKAQLSQAL	EIF3B	MAD1L1	chr7	2416710	chr7	2041756	2210

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EIF3B-MAD1L1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B53:01	1A1O	5654	LSQEQIKAQLSQAL	-2.521	-3.5563
HLA-B51:01	1E28	5654	LSQEQIKAQLSQAL	-1.92936	-2.96466
HLA-B57:03	2BVO	5654	LSQEQIKAQLSQAL	-3.93412	-4.04752
HLA-A03:01	2XPG	5654	LSQEQIKAQLSQAL	-4.06211	-4.17551
HLA-B14:02	3BVN	5654	LSQEQIKAQLSQAL	-5.90915	-6.02255
HLA-B14:02	3BVN	5654	LSQEQIKAQLSQAL	-3.14094	-4.17624
HLA-B27:09	3CZF	5654	LSQEQIKAQLSQAL	10001	10000
HLA-B44:03	3DX7	5654	LSQEQIKAQLSQAL	-0.694336	-1.72964
HLA-B52:01	3W39	5654	LSQEQIKAQLSQAL	-5.17909	-5.29249
HLA-B52:01	3W39	5654	LSQEQIKAQLSQAL	-3.78069	-4.81599
HLA-B18:01	4JQV	5654	LSQEQIKAQLSQAL	-3.7903	-4.8256
HLA-B18:01	4JQV	5654	LSQEQIKAQLSQAL	-2.32734	-2.44074
HLA-A11:01	4UQ2	5654	LSQEQIKAQLSQAL	-9.23212	-9.34552
HLA-A11:01	4UQ2	5654	LSQEQIKAQLSQAL	-8.48766	-9.52296
HLA-A24:02	5HGA	5654	LSQEQIKAQLSQAL	-7.36197	-7.47537
HLA-A24:02	5HGA	5654	LSQEQIKAQLSQAL	-3.3994	-4.4347
HLA-B57:01	5VUD	5654	LSQEQIKAQLSQAL	-2.43326	-3.46856
HLA-B27:05	6PYJ	5654	LSQEQIKAQLSQAL	-4.63681	-4.75021
HLA-B27:05	6PYJ	5654	LSQEQIKAQLSQAL	-2.95711	-3.99241
HLA-B27:03	6PZ5	5654	LSQEQIKAQLSQAL	-1.99721	-3.03251
HLA-B27:03	6PZ5	5654	LSQEQIKAQLSQAL	-1.21669	-1.33009
HLA-B44:05	3DX8	5654	LSQEQIKAQLSQAL	-4.55876	-4.67216
HLA-B44:05	3DX8	5654	LSQEQIKAQLSQAL	-4.48915	-5.52445
HLA-B07:02	5EO0	5654	LSQEQIKAQLSQAL	-1.42589	-2.46119
HLA-A02:01	6TDR	5654	LSQEQIKAQLSQAL	-2.39029	-3.42559

Top

Vaccine Design for the FusionNeoAntigens of EIF3B-MAD1L1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	11	20	IKAQLSQAL	ATCAAGGCTCAGCTGTCGCAGGCCCTG
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	12	20	KAQLSQAL	AAGGCTCAGCTGTCGCAGGCCCTG
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	7	16	SQEQIKAQL	AGCCAGGAACAGATCAAGGCTCAGCTG
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	8	16	QEQIKAQL	CAGGAACAGATCAAGGCTCAGCTG
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	8	17	QEQIKAQLS	CAGGAACAGATCAAGGCTCAGCTGTCG
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	8	19	QEQIKAQLSQA	CAGGAACAGATCAAGGCTCAGCTGTCGCAGGCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	2	17	PPTLLSQEQIKAQLS	CCTCCCACACTCCTGAGCCAGGAACAGATCAAGGCTCAGCTGTCG
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	7	22	SQEQIKAQLSQALEE	AGCCAGGAACAGATCAAGGCTCAGCTGTCGCAGGCCCTGGAGGAG
EIF3B-MAD1L1	chr7	2416710	chr7	2041756	8	23	QEQIKAQLSQALEEL	CAGGAACAGATCAAGGCTCAGCTGTCGCAGGCCCTGGAGGAGCTG

Top

Information of the samples that have these potential fusion neoantigens of EIF3B-MAD1L1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	EIF3B-MAD1L1	chr7	2416710	ENST00000360876	chr7	2041756	ENST00000265854	TCGA-A8-A08R-01A

Top

Potential target of CAR-T therapy development for EIF3B-MAD1L1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EIF3B-MAD1L1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EIF3B-MAD1L1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)