Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EIF3K-PPP2R2A

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EIF3K-PPP2R2A
	FusionPDB ID: 25888
	FusionGDB2.0 ID: 25888
		Hgene	Tgene
	Gene symbol	EIF3K	PPP2R2A
	Gene ID	27335	5520
	Gene name	eukaryotic translation initiation factor 3 subunit K	protein phosphatase 2 regulatory subunit Balpha
	Synonyms	ARG134\|EIF3-p28\|EIF3S12\|HSPC029\|M9\|MSTP001\|PLAC-24\|PLAC24\|PRO1474\|PTD001	B55A\|B55ALPHA\|PR52A\|PR55A\|PR55alpha
	Cytomap	19q13.2	8p21.2
	Type of gene	protein-coding	protein-coding
	Description	eukaryotic translation initiation factor 3 subunit KeIF-3 p28eukaryotic translation initiation factor 3, subunit 12muscle specificmuscle-specific gene M9 protein	serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoformprotein phosphatase 2, regulatory subunit B, alpha
	Modification date	20200322	20200327
	UniProtAcc	Q9UBQ5 Main function of 5'-partner protein: FUNCTION: Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773). {ECO:0000255\|HAMAP-Rule:MF_03010, ECO:0000269\|PubMed:17581632, ECO:0000269\|PubMed:25849773, ECO:0000269\|PubMed:27462815}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000593062, ENST00000248342, ENST00000538434, ENST00000545173, ENST00000588934, ENST00000592558, ENST00000593149,	ENST00000315985, ENST00000380737, ENST00000523473,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 9 X 4=324	8 X 13 X 5=520
	# samples	12	13
	** MAII score	log2(12/324*10)=-1.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(13/520*10)=-2 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EIF3K [Title/Abstract] AND PPP2R2A [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EIF3K [Title/Abstract] AND PPP2R2A [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EIF3K(39116742)-PPP2R2A(26227650), # samples:3
Anticipated loss of major functional domain due to fusion event.	EIF3K-PPP2R2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EIF3K-PPP2R2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EIF3K-PPP2R2A seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. EIF3K-PPP2R2A seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. EIF3K-PPP2R2A seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. EIF3K-PPP2R2A seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	EIF3K	GO:0006413	translational initiation	17581632
Tgene	PPP2R2A	GO:0006470	protein dephosphorylation	1849734

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:39116742/chr8:26227650)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EIF3K (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PPP2R2A (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000593149	EIF3K	chr19	39116742	+	ENST00000380737	PPP2R2A	chr8	26223831	+	3063	424	145	795	216
ENST00000593149	EIF3K	chr19	39116742	+	ENST00000315985	PPP2R2A	chr8	26223831	+	1269	424	145	795	216
ENST00000248342	EIF3K	chr19	39116742	+	ENST00000380737	PPP2R2A	chr8	26223831	+	3165	526	52	897	281
ENST00000248342	EIF3K	chr19	39116742	+	ENST00000315985	PPP2R2A	chr8	26223831	+	1371	526	52	897	281
ENST00000538434	EIF3K	chr19	39116742	+	ENST00000380737	PPP2R2A	chr8	26223831	+	2967	328	181	699	172
ENST00000538434	EIF3K	chr19	39116742	+	ENST00000315985	PPP2R2A	chr8	26223831	+	1173	328	181	699	172
ENST00000588934	EIF3K	chr19	39116742	+	ENST00000380737	PPP2R2A	chr8	26223831	+	3076	437	8	808	266
ENST00000588934	EIF3K	chr19	39116742	+	ENST00000315985	PPP2R2A	chr8	26223831	+	1282	437	8	808	266
ENST00000545173	EIF3K	chr19	39116742	+	ENST00000380737	PPP2R2A	chr8	26223831	+	3069	430	1	801	266
ENST00000545173	EIF3K	chr19	39116742	+	ENST00000315985	PPP2R2A	chr8	26223831	+	1275	430	1	801	266
ENST00000592558	EIF3K	chr19	39116742	+	ENST00000380737	PPP2R2A	chr8	26223831	+	3051	412	37	783	248
ENST00000592558	EIF3K	chr19	39116742	+	ENST00000315985	PPP2R2A	chr8	26223831	+	1257	412	37	783	248

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000593149	ENST00000380737	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.003064798	0.99693525
ENST00000593149	ENST00000315985	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.00455237	0.9954476
ENST00000248342	ENST00000380737	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.00063287	0.9993672
ENST00000248342	ENST00000315985	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.001723631	0.99827635
ENST00000538434	ENST00000380737	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.001552359	0.99844766
ENST00000538434	ENST00000315985	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.003025439	0.9969746
ENST00000588934	ENST00000380737	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.000591424	0.9994086
ENST00000588934	ENST00000315985	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.001299852	0.99870014
ENST00000545173	ENST00000380737	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.000588082	0.99941194
ENST00000545173	ENST00000315985	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.001278774	0.9987212
ENST00000592558	ENST00000380737	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.000591598	0.99940836
ENST00000592558	ENST00000315985	EIF3K	chr19	39116742	+	PPP2R2A	chr8	26223831	+	0.001263793	0.9987362

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EIF3K-PPP2R2A

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EIF3K	chr19	39116742	PPP2R2A	chr8	26223831	328	49	GDLLETCHFQAFWVHEYLRSKLCSLY
EIF3K	chr19	39116742	PPP2R2A	chr8	26223831	412	125	GDLLETCHFQAFWVHEYLRSKLCSLY
EIF3K	chr19	39116742	PPP2R2A	chr8	26223831	424	93	GDLLETCHFQAFWVHEYLRSKLCSLY
EIF3K	chr19	39116742	PPP2R2A	chr8	26223831	430	143	GDLLETCHFQAFWVHEYLRSKLCSLY
EIF3K	chr19	39116742	PPP2R2A	chr8	26223831	437	143	GDLLETCHFQAFWVHEYLRSKLCSLY
EIF3K	chr19	39116742	PPP2R2A	chr8	26223831	526	158	GDLLETCHFQAFWVHEYLRSKLCSLY

Top

Potential FusionNeoAntigen Information of EIF3K-PPP2R2A in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EIF3K-PPP2R2A_39116742_26223831.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:02	QAFWVHEY	0.9983	0.9749	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:05	QAFWVHEY	0.9983	0.7873	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B46:01	QAFWVHEY	0.9963	0.501	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:08	QAFWVHEY	0.996	0.9636	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:01	QAFWVHEY	0.9951	0.9615	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:01	FQAFWVHEY	0.9999	0.9575	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:25	FQAFWVHEY	0.9949	0.9788	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:02	FQAFWVHEY	0.9906	0.9814	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:08	FQAFWVHEY	0.9869	0.9636	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:01	FQAFWVHEY	0.9837	0.9707	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-A31:02	AFWVHEYLR	0.9672	0.6034	10	19
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:03	QAFWVHEYL	0.9643	0.9404	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B47:01	FQAFWVHEY	0.9512	0.7426	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B46:01	FQAFWVHEY	0.9455	0.5225	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:05	FQAFWVHEY	0.9143	0.8047	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:03	FQAFWVHEY	0.9104	0.8694	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:18	FQAFWVHEY	0.8715	0.8476	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:01	FQAFWVHEY	0.8685	0.9608	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:04	QAFWVHEYL	0.8277	0.976	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:02	QAFWVHEYL	0.8277	0.976	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B13:01	FQAFWVHEY	0.4729	0.9889	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-A32:13	FQAFWVHEY	0.3466	0.93	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:01	HFQAFWVHEY	0.9875	0.9557	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:18	CHFQAFWVHEY	0.9537	0.796	6	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:31	QAFWVHEY	0.9955	0.9586	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C15:04	QAFWVHEY	0.9881	0.9463	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:04	QAFWVHEY	0.9408	0.9919	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:14	QAFWVHEY	0.8901	0.9866	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:12	QAFWVHEY	0.8863	0.9273	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:07	FQAFWVHEY	0.9993	0.8008	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:08	QAFWVHEYL	0.9992	0.9442	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:07	QAFWVHEYL	0.9989	0.9896	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C15:06	QAFWVHEYL	0.9985	0.9581	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:19	QAFWVHEYL	0.9984	0.9915	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:12	QAFWVHEYL	0.9898	0.9486	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:04	QAFWVHEYL	0.9894	0.9928	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:21	FQAFWVHEY	0.9893	0.9712	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C06:03	QAFWVHEYL	0.9893	0.9939	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:05	FQAFWVHEY	0.9867	0.963	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:31	FQAFWVHEY	0.983	0.9658	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-A31:01	AFWVHEYLR	0.9746	0.5436	10	19
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:04	FQAFWVHEY	0.9729	0.9692	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:16	FQAFWVHEY	0.9589	0.9768	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:19	FQAFWVHEY	0.9254	0.7964	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:67	FQAFWVHEY	0.9086	0.978	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:80	FQAFWVHEY	0.9086	0.978	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:95	FQAFWVHEY	0.9074	0.8275	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:10	FQAFWVHEY	0.8863	0.9848	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:14	QAFWVHEYL	0.8848	0.9894	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:27	FQAFWVHEY	0.8666	0.9775	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:46	FQAFWVHEY	0.844	0.9509	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:12	QAFWVHEYL	0.8277	0.976	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:12	FQAFWVHEY	0.8223	0.9423	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B40:03	FQAFWVHEY	0.7807	0.5881	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C02:06	QAFWVHEYL	0.7697	0.9817	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:14	FQAFWVHEY	0.7114	0.9896	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:05	FQAFWVHEY	0.6959	0.9794	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B44:08	FQAFWVHEY	0.6554	0.6484	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:04	FQAFWVHEY	0.5903	0.995	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C06:03	FQAFWVHEY	0.5692	0.9953	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C15:04	FQAFWVHEY	0.5631	0.9404	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:07	HFQAFWVHEY	0.9741	0.7939	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:05	HFQAFWVHEY	0.9479	0.953	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:31	HFQAFWVHEY	0.9422	0.9571	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:21	HFQAFWVHEY	0.9382	0.964	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:17	QAFWVHEY	0.9984	0.9069	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:30	QAFWVHEY	0.9984	0.9069	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:11	QAFWVHEY	0.998	0.957	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:08	QAFWVHEY	0.9963	0.8858	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:11	QAFWVHEY	0.9961	0.9026	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:28	QAFWVHEY	0.9959	0.9812	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:23	QAFWVHEY	0.9954	0.962	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:77	QAFWVHEY	0.9951	0.9615	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:20	QAFWVHEY	0.9948	0.9838	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:43	QAFWVHEY	0.9948	0.8952	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C15:09	QAFWVHEY	0.9881	0.9463	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:24	QAFWVHEY	0.9834	0.9544	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:02	QAFWVHEY	0.9704	0.9748	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:04	QAFWVHEY	0.956	0.9573	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C16:04	QAFWVHEY	0.9488	0.9813	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:07	QAFWVHEY	0.9294	0.9119	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:06	QAFWVHEY	0.9246	0.9446	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:02	QAFWVHEY	0.9217	0.9763	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:08	QAFWVHEY	0.9093	0.7617	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:03	QAFWVHEY	0.8679	0.9792	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C02:10	QAFWVHEY	0.8191	0.9803	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C02:02	QAFWVHEY	0.8191	0.9803	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C16:01	QAFWVHEY	0.8067	0.9756	9	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:34	FQAFWVHEY	0.9999	0.9575	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:135	FQAFWVHEY	0.9999	0.9566	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:125	FQAFWVHEY	0.9999	0.9575	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:33	FQAFWVHEY	0.9999	0.9575	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:27	FQAFWVHEY	0.9999	0.9587	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:50	FQAFWVHEY	0.9998	0.9514	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:11	FQAFWVHEY	0.9998	0.9381	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:43	FQAFWVHEY	0.9997	0.9321	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:08	FQAFWVHEY	0.9997	0.9258	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:24	FQAFWVHEY	0.9994	0.9644	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:12	FQAFWVHEY	0.9993	0.9486	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:35	FQAFWVHEY	0.999	0.9413	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:03	QAFWVHEYL	0.9989	0.991	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:53	FQAFWVHEY	0.9989	0.9389	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:04	QAFWVHEYL	0.9989	0.991	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:17	QAFWVHEYL	0.9982	0.9755	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:05	QAFWVHEYL	0.9981	0.936	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:39	FQAFWVHEY	0.9947	0.9246	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:03	QAFWVHEYL	0.9916	0.9842	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:11	FQAFWVHEY	0.9912	0.97	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C16:04	QAFWVHEYL	0.9886	0.9875	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:20	FQAFWVHEY	0.9866	0.9826	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:20	FQAFWVHEY	0.9855	0.9863	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:23	FQAFWVHEY	0.9854	0.9716	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:77	FQAFWVHEY	0.9837	0.9707	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:28	FQAFWVHEY	0.98	0.9841	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:06	QAFWVHEYL	0.9797	0.992	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:11	FQAFWVHEY	0.974	0.9569	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:02	QAFWVHEYL	0.9677	0.9791	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:17	FQAFWVHEY	0.9676	0.927	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:30	FQAFWVHEY	0.9676	0.927	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:13	QAFWVHEYL	0.9589	0.9419	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:54	FQAFWVHEY	0.9584	0.9387	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:13	FQAFWVHEY	0.941	0.8989	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:04	FQAFWVHEY	0.9351	0.9705	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:02	FQAFWVHEY	0.9299	0.9817	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C12:03	FQAFWVHEY	0.9271	0.9858	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:22	QAFWVHEYL	0.9166	0.5852	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:02	FQAFWVHEY	0.9086	0.978	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:24	FQAFWVHEY	0.9083	0.9705	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:01	FQAFWVHEY	0.9009	0.779	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:22	FQAFWVHEY	0.8979	0.8808	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:07	FQAFWVHEY	0.8862	0.9372	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:08	FQAFWVHEY	0.8851	0.8065	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C07:17	FQAFWVHEY	0.8803	0.9815	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:05	FQAFWVHEY	0.8685	0.9608	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-A68:02	QAFWVHEYL	0.8648	0.8039	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:06	FQAFWVHEY	0.8626	0.9653	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B18:03	FQAFWVHEY	0.8528	0.9592	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:09	QAFWVHEYL	0.8277	0.976	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-A69:01	QAFWVHEYL	0.8216	0.8619	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B51:09	QAFWVHEYL	0.8055	0.54	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:73	FQAFWVHEY	0.7948	0.7921	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B48:02	FQAFWVHEY	0.7917	0.9819	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:68	FQAFWVHEY	0.7427	0.7734	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C03:02	FQAFWVHEY	0.7302	0.9835	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C17:01	QAFWVHEYL	0.6318	0.9547	9	18
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C16:01	FQAFWVHEY	0.615	0.9801	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C16:04	FQAFWVHEY	0.5907	0.9881	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C15:09	FQAFWVHEY	0.5631	0.9404	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-A32:01	FQAFWVHEY	0.5418	0.9365	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-A25:01	FQAFWVHEY	0.5223	0.9072	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C06:02	FQAFWVHEY	0.5203	0.9938	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C06:17	FQAFWVHEY	0.5203	0.9938	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C16:02	FQAFWVHEY	0.3995	0.9923	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C06:06	FQAFWVHEY	0.3511	0.9908	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C02:02	FQAFWVHEY	0.3478	0.9891	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C02:10	FQAFWVHEY	0.3478	0.9891	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-C06:08	FQAFWVHEY	0.2645	0.9928	8	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:50	HFQAFWVHEY	0.9907	0.9405	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:34	HFQAFWVHEY	0.9875	0.9557	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:125	HFQAFWVHEY	0.9875	0.9557	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:27	HFQAFWVHEY	0.9875	0.9633	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:33	HFQAFWVHEY	0.9875	0.9557	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:135	HFQAFWVHEY	0.9851	0.9571	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:12	HFQAFWVHEY	0.9814	0.928	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:53	HFQAFWVHEY	0.9764	0.9387	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:35	HFQAFWVHEY	0.9748	0.9442	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B15:20	HFQAFWVHEY	0.9432	0.9757	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:20	HFQAFWVHEY	0.9388	0.9805	7	17
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	526	HLA-B35:28	HFQAFWVHEY	0.9333	0.9782	7	17

Top

Potential FusionNeoAntigen Information of EIF3K-PPP2R2A in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of EIF3K-PPP2R2A

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
832	CHFQAFWVHEYLRS	EIF3K	PPP2R2A	chr19	39116742	chr8	26223831	526

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EIF3K-PPP2R2A

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	832	CHFQAFWVHEYLRS	-7.28656	-7.39996
HLA-B14:02	3BVN	832	CHFQAFWVHEYLRS	-5.68504	-6.72034
HLA-B52:01	3W39	832	CHFQAFWVHEYLRS	-7.45611	-7.56951
HLA-B52:01	3W39	832	CHFQAFWVHEYLRS	-4.23128	-5.26658
HLA-A24:02	5HGA	832	CHFQAFWVHEYLRS	-5.90012	-6.01352
HLA-A24:02	5HGA	832	CHFQAFWVHEYLRS	-5.24438	-6.27968
HLA-B44:05	3DX8	832	CHFQAFWVHEYLRS	-6.74318	-6.85658
HLA-B44:05	3DX8	832	CHFQAFWVHEYLRS	-3.24185	-4.27715
HLA-A02:01	6TDR	832	CHFQAFWVHEYLRS	-7.43467	-7.54807

Top

Vaccine Design for the FusionNeoAntigens of EIF3K-PPP2R2A

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	10	19	AFWVHEYLR	GCCTTCTGGGTGCATGAATACCTCAGA
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	6	17	CHFQAFWVHEY	TGCCATTTCCAGGCCTTCTGGGTGCATGAATAC
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	7	17	HFQAFWVHEY	CATTTCCAGGCCTTCTGGGTGCATGAATAC
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	8	17	FQAFWVHEY	TTCCAGGCCTTCTGGGTGCATGAATAC
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	9	17	QAFWVHEY	CAGGCCTTCTGGGTGCATGAATAC
EIF3K-PPP2R2A	chr19	39116742	chr8	26223831	9	18	QAFWVHEYL	CAGGCCTTCTGGGTGCATGAATACCTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of EIF3K-PPP2R2A

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUSC	EIF3K-PPP2R2A	chr19	39116742	ENST00000248342	chr8	26223831	ENST00000315985	TCGA-77-7338

Top

Potential target of CAR-T therapy development for EIF3K-PPP2R2A

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EIF3K-PPP2R2A

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EIF3K-PPP2R2A

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)