Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ELF1-EZR

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ELF1-EZR
	FusionPDB ID: 26152
	FusionGDB2.0 ID: 26152
		Hgene	Tgene
	Gene symbol	ELF1	EZR
	Gene ID	84337	7430
	Gene name	elongation factor 1 homolog	ezrin
	Synonyms	ELF1	CVIL\|CVL\|HEL-S-105\|VIL2
	Cytomap	19p13.2	6q25.3
	Type of gene	protein-coding	protein-coding
	Description	transcription elongation factor 1 homologELF1 homolog, elongation factor 1elongation factor 1 homolog (ELF1, S. cerevisiae)	ezrincytovillin 2epididymis secretory protein Li 105p81villin 2 (ezrin)
	Modification date	20200313	20200322
	UniProtAcc	P32519 Main function of 5'-partner protein: FUNCTION: Transcription factor that activates the LYN and BLK promoters. Appears to be required for the T-cell-receptor-mediated trans activation of HIV-2 gene expression. Binds specifically to two purine-rich motifs in the HIV-2 enhancer. {ECO:0000269\|PubMed:8756667}.	P15311 Main function of 5'-partner protein: FUNCTION: Probably involved in connections of major cytoskeletal structures to the plasma membrane. In epithelial cells, required for the formation of microvilli and membrane ruffles on the apical pole. Along with PLEKHG6, required for normal macropinocytosis. {ECO:0000269\|PubMed:17881735, ECO:0000269\|PubMed:18270268, ECO:0000269\|PubMed:19111582}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000239882, ENST00000442101, ENST00000498824,	ENST00000476189, ENST00000337147, ENST00000367075, ENST00000392177,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 11 X 6=1188	25 X 24 X 6=3600
	# samples	17	27
	** MAII score	log2(17/1188*10)=-2.80492818466306 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(27/3600*10)=-3.73696559416621 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ELF1 [Title/Abstract] AND EZR [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ELF1 [Title/Abstract] AND EZR [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ELF1(41556119)-EZR(159210403), # samples:1
Anticipated loss of major functional domain due to fusion event.	ELF1-EZR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ELF1-EZR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ELF1-EZR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ELF1-EZR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	EZR	GO:0048015	phosphatidylinositol-mediated signaling	25591774
Tgene	EZR	GO:0051017	actin filament bundle assembly	10793131

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr13:41556119/chr6:159210403)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ELF1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EZR (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000442101	ELF1	chr13	41556119	-	ENST00000337147	EZR	chr6	159210403	-	3222	300	228	2048	606
ENST00000442101	ELF1	chr13	41556119	-	ENST00000367075	EZR	chr6	159210403	-	3215	300	228	2048	606
ENST00000442101	ELF1	chr13	41556119	-	ENST00000392177	EZR	chr6	159210403	-	1971	300	228	1952	574
ENST00000239882	ELF1	chr13	41556119	-	ENST00000337147	EZR	chr6	159210403	-	3309	387	315	2135	606
ENST00000239882	ELF1	chr13	41556119	-	ENST00000367075	EZR	chr6	159210403	-	3302	387	315	2135	606
ENST00000239882	ELF1	chr13	41556119	-	ENST00000392177	EZR	chr6	159210403	-	2058	387	315	2039	574

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000442101	ENST00000337147	ELF1	chr13	41556119	-	EZR	chr6	159210403	-	0.002979906	0.99702007
ENST00000442101	ENST00000367075	ELF1	chr13	41556119	-	EZR	chr6	159210403	-	0.002890623	0.99710935
ENST00000442101	ENST00000392177	ELF1	chr13	41556119	-	EZR	chr6	159210403	-	0.007696667	0.9923034
ENST00000239882	ENST00000337147	ELF1	chr13	41556119	-	EZR	chr6	159210403	-	0.002771165	0.9972288
ENST00000239882	ENST00000367075	ELF1	chr13	41556119	-	EZR	chr6	159210403	-	0.002683649	0.9973163
ENST00000239882	ENST00000392177	ELF1	chr13	41556119	-	EZR	chr6	159210403	-	0.00727407	0.99272597

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ELF1-EZR

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ELF1	chr13	41556119	EZR	chr6	159210403	300	23	VFEFASNVMEDERQINVRVTTMDAEL
ELF1	chr13	41556119	EZR	chr6	159210403	387	23	VFEFASNVMEDERQINVRVTTMDAEL

Top

Potential FusionNeoAntigen Information of ELF1-EZR in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ELF1-EZR_41556119_159210403.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B45:01	MEDERQINV	0.9989	0.7686	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B45:01	DERQINVRV	0.9948	0.9056	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B50:02	DERQINVRV	0.9885	0.5953	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B41:01	MEDERQINV	0.9709	0.9283	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B48:01	RQINVRVTT	0.9473	0.6589	12	21
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B47:01	MEDERQINV	0.9185	0.5167	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B18:01	DERQINVRV	0.9059	0.9013	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B50:01	MEDERQINV	0.8694	0.7272	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B39:13	MEDERQINV	0.6698	0.9348	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B13:02	RQINVRVTT	0.6498	0.7413	12	21
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:01	RQINVRVTTM	0.9997	0.8682	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B48:01	RQINVRVTTM	0.9849	0.644	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:03	RQINVRVTTM	0.9624	0.779	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:25	RQINVRVTTM	0.9399	0.8766	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B13:02	RQINVRVTTM	0.8308	0.7744	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B13:01	RQINVRVTTM	0.7594	0.9288	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B40:06	MEDERQINV	0.9998	0.5159	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B39:08	MEDERQINV	0.8671	0.8872	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:04	RQINVRVTT	0.7238	0.8743	12	21
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B39:09	MEDERQINV	0.6946	0.6382	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B51:07	DERQINVRV	0.6427	0.7643	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B39:05	MEDERQINV	0.5602	0.879	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B51:07	MEDERQINV	0.557	0.7879	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:04	RQINVRVTTM	0.9975	0.8912	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:07	RQINVRVTTM	0.997	0.788	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-A02:07	VMEDERQINV	0.9499	0.5319	7	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B73:01	ERQINVRVTT	0.9178	0.9046	11	21
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:05	RQINVRVTTM	0.7403	0.8714	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-C18:01	MEDERQINV	0.9996	0.7627	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B40:04	MEDERQINV	0.9986	0.678	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B41:03	MEDERQINV	0.9658	0.679	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B18:06	DERQINVRV	0.9068	0.9385	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B18:05	DERQINVRV	0.9059	0.9013	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B18:08	DERQINVRV	0.9032	0.9703	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B50:04	MEDERQINV	0.8694	0.7272	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B50:05	MEDERQINV	0.8694	0.7272	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B18:03	DERQINVRV	0.8528	0.8973	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B39:11	MEDERQINV	0.8522	0.8559	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B39:31	MEDERQINV	0.7563	0.892	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B39:02	MEDERQINV	0.6611	0.9343	8	17
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B18:11	DERQINVRV	0.4758	0.8809	10	19
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:135	RQINVRVTTM	0.9997	0.8524	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:34	RQINVRVTTM	0.9997	0.8682	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:125	RQINVRVTTM	0.9997	0.8682	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:33	RQINVRVTTM	0.9997	0.8682	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:27	RQINVRVTTM	0.9997	0.8722	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:50	RQINVRVTTM	0.9995	0.9334	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:24	RQINVRVTTM	0.9995	0.8147	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:53	RQINVRVTTM	0.9991	0.8605	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:68	RQINVRVTTM	0.9987	0.7346	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:54	RQINVRVTTM	0.9983	0.842	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:12	RQINVRVTTM	0.9958	0.8605	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:35	RQINVRVTTM	0.9949	0.8795	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:73	RQINVRVTTM	0.99	0.955	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:30	RQINVRVTTM	0.9809	0.9457	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:39	RQINVRVTTM	0.9499	0.8138	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B48:02	RQINVRVTTM	0.8338	0.9154	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B15:20	RQINVRVTTM	0.7402	0.9163	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-B40:21	RQINVRVTTM	0.7359	0.5761	12	22
ELF1-EZR	chr13	41556119	chr6	159210403	387	HLA-A69:01	NVMEDERQINV	0.9924	0.6828	6	17

Top

Potential FusionNeoAntigen Information of ELF1-EZR in HLA II

ELF1-EZR_41556119_159210403.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ELF1-EZR	chr13	41556119	chr6	159210403	387	DRB1-0806	DERQINVRVTTMDAE	10	25
ELF1-EZR	chr13	41556119	chr6	159210403	387	DRB1-0810	DERQINVRVTTMDAE	10	25
ELF1-EZR	chr13	41556119	chr6	159210403	387	DRB1-0812	DERQINVRVTTMDAE	10	25
ELF1-EZR	chr13	41556119	chr6	159210403	387	DRB1-0822	DERQINVRVTTMDAE	10	25

Top

Fusion breakpoint peptide structures of ELF1-EZR

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6443	NVMEDERQINVRVT	ELF1	EZR	chr13	41556119	chr6	159210403	387

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ELF1-EZR

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6443	NVMEDERQINVRVT	-5.16857	-5.28197
HLA-B14:02	3BVN	6443	NVMEDERQINVRVT	-4.21097	-5.24627
HLA-B52:01	3W39	6443	NVMEDERQINVRVT	-4.32839	-4.44179
HLA-B52:01	3W39	6443	NVMEDERQINVRVT	-4.10962	-5.14492
HLA-A24:02	5HGA	6443	NVMEDERQINVRVT	-6.03661	-6.15001
HLA-A24:02	5HGA	6443	NVMEDERQINVRVT	-5.99594	-7.03124
HLA-B44:05	3DX8	6443	NVMEDERQINVRVT	-6.27779	-6.39119
HLA-B44:05	3DX8	6443	NVMEDERQINVRVT	-4.76488	-5.80018

Top

Vaccine Design for the FusionNeoAntigens of ELF1-EZR

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ELF1-EZR	chr13	41556119	chr6	159210403	10	19	DERQINVRV	GAACGACAGATCAATGTCCGAGTTACC
ELF1-EZR	chr13	41556119	chr6	159210403	11	21	ERQINVRVTT	CGACAGATCAATGTCCGAGTTACCACCATG
ELF1-EZR	chr13	41556119	chr6	159210403	12	21	RQINVRVTT	CAGATCAATGTCCGAGTTACCACCATG
ELF1-EZR	chr13	41556119	chr6	159210403	12	22	RQINVRVTTM	CAGATCAATGTCCGAGTTACCACCATGGAT
ELF1-EZR	chr13	41556119	chr6	159210403	6	17	NVMEDERQINV	GTCATGGAGGATGAACGACAGATCAATGTCCGA
ELF1-EZR	chr13	41556119	chr6	159210403	7	17	VMEDERQINV	ATGGAGGATGAACGACAGATCAATGTCCGA
ELF1-EZR	chr13	41556119	chr6	159210403	8	17	MEDERQINV	GAGGATGAACGACAGATCAATGTCCGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ELF1-EZR	chr13	41556119	chr6	159210403	10	25	DERQINVRVTTMDAE	GAACGACAGATCAATGTCCGAGTTACCACCATGGATGCAGAGCTG

Top

Information of the samples that have these potential fusion neoantigens of ELF1-EZR

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ELF1-EZR	chr13	41556119	ENST00000239882	chr6	159210403	ENST00000337147	TCGA-CD-8531-01A

Top

Potential target of CAR-T therapy development for ELF1-EZR

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ELF1-EZR

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ELF1-EZR

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	EZR	C0033578	Prostatic Neoplasms	3	CTD_human
Tgene	EZR	C0376358	Malignant neoplasm of prostate	3	CTD_human
Tgene	EZR	C0007097	Carcinoma	1	CTD_human
Tgene	EZR	C0023893	Liver Cirrhosis, Experimental	1	CTD_human
Tgene	EZR	C0024667	Animal Mammary Neoplasms	1	CTD_human
Tgene	EZR	C0024668	Mammary Neoplasms, Experimental	1	CTD_human
Tgene	EZR	C0027627	Neoplasm Metastasis	1	CTD_human
Tgene	EZR	C0029408	Degenerative polyarthritis	1	CTD_human
Tgene	EZR	C0086743	Osteoarthrosis Deformans	1	CTD_human
Tgene	EZR	C0205696	Anaplastic carcinoma	1	CTD_human
Tgene	EZR	C0205697	Carcinoma, Spindle-Cell	1	CTD_human
Tgene	EZR	C0205698	Undifferentiated carcinoma	1	CTD_human
Tgene	EZR	C0205699	Carcinomatosis	1	CTD_human
Tgene	EZR	C1257925	Mammary Carcinoma, Animal	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)