Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ENSA-CTSS

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ENSA-CTSS
	FusionPDB ID: 26663
	FusionGDB2.0 ID: 26663
		Hgene	Tgene
	Gene symbol	ENSA	CTSS
	Gene ID	2029	1520
	Gene name	endosulfine alpha	cathepsin S
	Synonyms	ARPP-19e	-
	Cytomap	1q21.3	1q21.3
	Type of gene	protein-coding	protein-coding
	Description	alpha-endosulfine	cathepsin S
	Modification date	20200313	20200329
	UniProtAcc	O43768 Main function of 5'-partner protein: FUNCTION: Protein phosphatase inhibitor that specifically inhibits protein phosphatase 2A (PP2A) during mitosis. When phosphorylated at Ser-67 during mitosis, specifically interacts with PPP2R2D (PR55-delta) and inhibits its activity, leading to inactivation of PP2A, an essential condition to keep cyclin-B1-CDK1 activity high during M phase (By similarity). Also acts as a stimulator of insulin secretion by interacting with sulfonylurea receptor (ABCC8), thereby preventing sulfonylurea from binding to its receptor and reducing K(ATP) channel currents. {ECO:0000250, ECO:0000269\|PubMed:9653196}.	P25774 Main function of 5'-partner protein: FUNCTION: Thiol protease. Key protease responsible for the removal of the invariant chain from MHC class II molecules and MHC class II antigen presentation (PubMed:30612035). The bond-specificity of this proteinase is in part similar to the specificities of cathepsin L. {ECO:0000269\|PubMed:30612035}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000271690, ENST00000339643, ENST00000361532, ENST00000361631, ENST00000369009, ENST00000369014, ENST00000369016, ENST00000503241, ENST00000513281, ENST00000354702, ENST00000356527, ENST00000362052, ENST00000503345,	ENST00000480760, ENST00000368985, ENST00000448301,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 11 X 6=858	14 X 15 X 9=1890
	# samples	17	19
	** MAII score	log2(17/858*10)=-2.33544290136184 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(19/1890*10)=-3.31431491077749 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ENSA [Title/Abstract] AND CTSS [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ENSA [Title/Abstract] AND CTSS [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ENSA(150599943)-CTSS(150727626), # samples:1 ENSA(150599942)-CTSS(150727626), # samples:1 ENSA(150598117)-CTSS(150737240), # samples:1
Anticipated loss of major functional domain due to fusion event.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ENSA	GO:0050796	regulation of insulin secretion	9653196
Tgene	CTSS	GO:0006508	proteolysis	12788072\|22864553
Tgene	CTSS	GO:0010447	response to acidic pH	22864553
Tgene	CTSS	GO:0016485	protein processing	22864553
Tgene	CTSS	GO:0030574	collagen catabolic process	22952693
Tgene	CTSS	GO:0034769	basement membrane disassembly	22952693
Tgene	CTSS	GO:0048002	antigen processing and presentation of peptide antigen	8612130
Tgene	CTSS	GO:0051603	proteolysis involved in cellular protein catabolic process	22952693
Tgene	CTSS	GO:2001259	positive regulation of cation channel activity	22864553

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:150599943/chr1:150727626)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ENSA (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CTSS (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000369016	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3876	279	18	1025	335
ENST00000369014	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3906	309	48	1055	335
ENST00000339643	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3886	289	28	1035	335
ENST00000271690	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3887	290	29	1036	335
ENST00000503241	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3869	272	11	1018	335
ENST00000361532	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3803	206	35	952	305
ENST00000361631	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3791	194	23	940	305
ENST00000513281	ENSA	chr1	150599943	-	ENST00000368985	CTSS	chr1	150727626	-	3779	182	11	928	305
ENST00000369016	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3876	279	18	1025	335
ENST00000369014	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3906	309	48	1055	335
ENST00000339643	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3886	289	28	1035	335
ENST00000271690	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3887	290	29	1036	335
ENST00000503241	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3869	272	11	1018	335
ENST00000361532	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3803	206	35	952	305
ENST00000361631	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3791	194	23	940	305
ENST00000513281	ENSA	chr1	150599942	-	ENST00000368985	CTSS	chr1	150727626	-	3779	182	11	928	305

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000369016	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.000363631	0.9996364
ENST00000369014	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.000381922	0.99961805
ENST00000339643	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.000370269	0.99962974
ENST00000271690	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.000370586	0.9996294
ENST00000503241	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.000356004	0.99964404
ENST00000361532	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.00055552	0.9994444
ENST00000361631	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.000568119	0.9994319
ENST00000513281	ENST00000368985	ENSA	chr1	150599943	-	CTSS	chr1	150727626	-	0.00056484	0.9994351
ENST00000369016	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.000363631	0.9996364
ENST00000369014	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.000381922	0.99961805
ENST00000339643	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.000370269	0.99962974
ENST00000271690	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.000370586	0.9996294
ENST00000503241	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.000356004	0.99964404
ENST00000361532	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.00055552	0.9994444
ENST00000361631	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.000568119	0.9994319
ENST00000513281	ENST00000368985	ENSA	chr1	150599942	-	CTSS	chr1	150727626	-	0.00056484	0.9994351

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ENSA-CTSS

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ENSA	chr1	150599942	CTSS	chr1	150727626	182	57	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599942	CTSS	chr1	150727626	194	57	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599942	CTSS	chr1	150727626	206	57	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599942	CTSS	chr1	150727626	272	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599942	CTSS	chr1	150727626	279	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599942	CTSS	chr1	150727626	289	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599942	CTSS	chr1	150727626	290	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599942	CTSS	chr1	150727626	309	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	182	57	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	194	57	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	206	57	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	272	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	279	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	289	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	290	87	GGSDFLMKRLQKGTSEEVMSLMSSLR
ENSA	chr1	150599943	CTSS	chr1	150727626	309	87	GGSDFLMKRLQKGTSEEVMSLMSSLR

Top

Potential FusionNeoAntigen Information of ENSA-CTSS in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ENSA-CTSS_150599942_150727626.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-A02:38	GTSEEVMSL	0.9694	0.7394	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-A02:21	GTSEEVMSL	0.9096	0.7092	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-A02:20	GTSEEVMSL	0.7922	0.5929	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B13:02	LQKGTSEEV	0.6463	0.9654	9	18
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B52:01	LQKGTSEEV	0.025	0.9922	9	18
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:01	LQKGTSEEVM	0.9995	0.9273	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B13:02	RLQKGTSEEV	0.3413	0.9399	8	18
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C15:06	GTSEEVMSL	0.9991	0.931	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C15:04	GTSEEVMSL	0.9989	0.9376	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C03:07	GTSEEVMSL	0.9989	0.9879	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C03:08	GTSEEVMSL	0.9985	0.9143	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C04:06	GTSEEVMSL	0.9923	0.9618	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:04	LQKGTSEEV	0.9177	0.9257	9	18
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C02:06	GTSEEVMSL	0.6649	0.9672	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:04	LQKGTSEEVM	0.9977	0.9554	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C15:05	GTSEEVMSL	0.9991	0.9504	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C15:02	GTSEEVMSL	0.999	0.9288	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C15:09	GTSEEVMSL	0.9989	0.9376	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C03:06	GTSEEVMSL	0.9884	0.991	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:73	LQKGTSEEV	0.9425	0.9785	9	18
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C16:02	GTSEEVMSL	0.9246	0.9965	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-A02:14	GTSEEVMSL	0.9127	0.5695	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-A02:06	GTSEEVMSL	0.9096	0.7092	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:30	LQKGTSEEV	0.8482	0.9722	9	18
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-C17:01	GTSEEVMSL	0.5775	0.9846	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:73	GTSEEVMSL	0.5499	0.9854	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B35:13	GTSEEVMSL	0.5476	0.8669	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:30	GTSEEVMSL	0.4868	0.9768	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B40:21	GTSEEVMSL	0.1034	0.8283	12	21
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:33	LQKGTSEEVM	0.9995	0.9273	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:27	LQKGTSEEVM	0.9995	0.9488	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:125	LQKGTSEEVM	0.9995	0.9273	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:34	LQKGTSEEVM	0.9995	0.9273	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:53	LQKGTSEEVM	0.9978	0.9291	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:50	LQKGTSEEVM	0.9955	0.9074	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:54	LQKGTSEEVM	0.994	0.9088	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:73	LQKGTSEEVM	0.9907	0.9862	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:30	LQKGTSEEVM	0.9885	0.9804	9	19
ENSA-CTSS	chr1	150599942	chr1	150727626	290	HLA-B15:12	LQKGTSEEVM	0.9778	0.9319	9	19

Top

Potential FusionNeoAntigen Information of ENSA-CTSS in HLA II

ENSA-CTSS_150599942_150727626.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ENSA-CTSS	chr1	150599942	chr1	150727626	290	DRB1-1427	GSDFLMKRLQKGTSE	1	16

Top

Fusion breakpoint peptide structures of ENSA-CTSS

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5941	MKRLQKGTSEEVMS	ENSA	CTSS	chr1	150599942	chr1	150727626	290

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ENSA-CTSS

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	5941	MKRLQKGTSEEVMS	-6.96153	-6.96153
HLA-B44:05	3DX8	5941	MKRLQKGTSEEVMS	-4.80407	-4.80407

Top

Vaccine Design for the FusionNeoAntigens of ENSA-CTSS

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ENSA-CTSS	chr1	150599942	chr1	150727626	12	21	GTSEEVMSL	GGGACCAGTGAAGAAGTGATGTCTTTG
ENSA-CTSS	chr1	150599942	chr1	150727626	8	18	RLQKGTSEEV	AGACTCCAGAAAGGGACCAGTGAAGAAGTG
ENSA-CTSS	chr1	150599942	chr1	150727626	9	18	LQKGTSEEV	CTCCAGAAAGGGACCAGTGAAGAAGTG
ENSA-CTSS	chr1	150599942	chr1	150727626	9	19	LQKGTSEEVM	CTCCAGAAAGGGACCAGTGAAGAAGTGATG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ENSA-CTSS	chr1	150599942	chr1	150727626	1	16	GSDFLMKRLQKGTSE	GGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGACCAGTGAA

Top

Information of the samples that have these potential fusion neoantigens of ENSA-CTSS

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ENSA-CTSS	chr1	150599942	ENST00000271690	chr1	150727626	ENST00000368985	TCGA-D7-A6F0

Top

Potential target of CAR-T therapy development for ENSA-CTSS

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ENSA-CTSS

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ENSA-CTSS

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)