|
|||||||
|
Fusion Protein:EP300-TNRC6B |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: EP300-TNRC6B | FusionPDB ID: 26760 | FusionGDB2.0 ID: 26760 | Hgene | Tgene | Gene symbol | EP300 | TNRC6B | Gene ID | 2033 | 23112 |
| Gene name | E1A binding protein p300 | trinucleotide repeat containing adaptor 6B | |
| Synonyms | KAT3B|MKHK2|RSTS2|p300 | - | |
| Cytomap | 22q13.2 | 22q13.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | histone acetyltransferase p300E1A-associated protein p300E1A-binding protein, 300kDhistone butyryltransferase p300histone crotonyltransferase p300p300 HATprotein 2-hydroxyisobutyryltransferase p300protein propionyltransferase p300 | trinucleotide repeat-containing gene 6B proteintrinucleotide repeat containing 6B | |
| Modification date | 20200329 | 20200313 | |
| UniProtAcc | Q09472 Main function of 5'-partner protein: FUNCTION: Functions as histone acetyltransferase and regulates transcription via chromatin remodeling (PubMed:23415232, PubMed:23934153, PubMed:8945521). Acetylates all four core histones in nucleosomes. Histone acetylation gives an epigenetic tag for transcriptional activation (PubMed:23415232, PubMed:23934153, PubMed:8945521). Mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. Mediates acetylation of histone H3 at 'Lys-122' (H3K122ac), a modification that localizes at the surface of the histone octamer and stimulates transcription, possibly by promoting nucleosome instability. Mediates acetylation of histone H3 at 'Lys-27' (H3K27ac) (PubMed:23911289). Also functions as acetyltransferase for non-histone targets, such as ALX1, HDAC1, PRMT1 or SIRT2 (PubMed:12929931, PubMed:16762839, PubMed:18722353). Acetylates 'Lys-131' of ALX1 and acts as its coactivator (PubMed:12929931). Acetylates SIRT2 and is proposed to indirectly increase the transcriptional activity of p53/TP53 through acetylation and subsequent attenuation of SIRT2 deacetylase function (PubMed:18722353). Following DNA damage, forms a stress-responsive p53/TP53 coactivator complex with JMY which mediates p53/TP53 acetylation, thereby increasing p53/TP53-dependent transcription and apoptosis (PubMed:11511361, PubMed:15448695). Promotes chromatin acetylation in heat shock responsive HSP genes during the heat shock response (HSR), thereby stimulating HSR transcription (PubMed:18451878). Acetylates HDAC1 leading to its inactivation and modulation of transcription (PubMed:16762839). Acetylates 'Lys-247' of EGR2 (By similarity). Acts as a TFAP2A-mediated transcriptional coactivator in presence of CITED2 (PubMed:12586840). Plays a role as a coactivator of NEUROD1-dependent transcription of the secretin and p21 genes and controls terminal differentiation of cells in the intestinal epithelium. Promotes cardiac myocyte enlargement. Can also mediate transcriptional repression. Acetylates FOXO1 and enhances its transcriptional activity (PubMed:15890677). Acetylates BCL6 wich disrupts its ability to recruit histone deacetylases and hinders its transcriptional repressor activity (PubMed:12402037). Participates in CLOCK or NPAS2-regulated rhythmic gene transcription; exhibits a circadian association with CLOCK or NPAS2, correlating with increase in PER1/2 mRNA and histone H3 acetylation on the PER1/2 promoter (PubMed:14645221). Acetylates MTA1 at 'Lys-626' which is essential for its transcriptional coactivator activity (PubMed:16617102). Acetylates XBP1 isoform 2; acetylation increases protein stability of XBP1 isoform 2 and enhances its transcriptional activity (PubMed:20955178). Acetylates PCNA; acetylation promotes removal of chromatin-bound PCNA and its degradation during nucleotide excision repair (NER) (PubMed:24939902). Acetylates MEF2D (PubMed:21030595). Acetylates and stabilizes ZBTB7B protein by antagonizing ubiquitin conjugation and degradation, this mechanism may be involved in CD4/CD8 lineage differentiation (PubMed:20810990). Acetylates GABPB1, impairing GABPB1 heterotetramerization and activity (By similarity). Acetylates PCK1 and promotes PCK1 anaplerotic activity (PubMed:30193097). Acetylates RXRA and RXRG (PubMed:17761950). In addition to protein acetyltransferase, can use different acyl-CoA substrates, such as (2E)-butenoyl-CoA (crotonyl-CoA), butanoyl-CoA (butyryl-CoA), 2-hydroxyisobutanoyl-CoA (2-hydroxyisobutyryl-CoA), lactoyl-CoA or propanoyl-CoA (propionyl-CoA), and is able to mediate protein crotonylation, butyrylation, 2-hydroxyisobutyrylation, lactylation or propionylation, respectively (PubMed:17267393, PubMed:25818647, PubMed:29775581, PubMed:31645732). Acts as a histone crotonyltransferase; crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors (PubMed:25818647). Histone crotonyltransferase activity is dependent on the concentration of (2E)-butenoyl-CoA (crotonyl-CoA) substrate and such activity is weak when (2E)-butenoyl-CoA (crotonyl-CoA) concentration is low (PubMed:25818647). Also acts as a histone butyryltransferase; butyrylation marks active promoters (PubMed:17267393). Catalyzes histone lactylation in macrophages by using lactoyl-CoA directly derived from endogenous or exogenous lactate, leading to stimulates gene transcription (PubMed:31645732). Acts as a protein-lysine 2-hydroxyisobutyryltransferase; regulates glycolysis by mediating 2-hydroxyisobutyrylation of glycolytic enzymes (PubMed:29775581). Functions as a transcriptional coactivator for SMAD4 in the TGF-beta signaling pathway (PubMed:25514493). {ECO:0000250|UniProtKB:B2RWS6, ECO:0000269|PubMed:10733570, ECO:0000269|PubMed:11430825, ECO:0000269|PubMed:11511361, ECO:0000269|PubMed:11701890, ECO:0000269|PubMed:12402037, ECO:0000269|PubMed:12586840, ECO:0000269|PubMed:12929931, ECO:0000269|PubMed:14645221, ECO:0000269|PubMed:15186775, ECO:0000269|PubMed:15448695, ECO:0000269|PubMed:15890677, ECO:0000269|PubMed:16617102, ECO:0000269|PubMed:16762839, ECO:0000269|PubMed:17267393, ECO:0000269|PubMed:17761950, ECO:0000269|PubMed:18451878, ECO:0000269|PubMed:18722353, ECO:0000269|PubMed:18995842, ECO:0000269|PubMed:20810990, ECO:0000269|PubMed:21030595, ECO:0000269|PubMed:23415232, ECO:0000269|PubMed:23911289, ECO:0000269|PubMed:23934153, ECO:0000269|PubMed:24939902, ECO:0000269|PubMed:25514493, ECO:0000269|PubMed:25818647, ECO:0000269|PubMed:29775581, ECO:0000269|PubMed:30193097, ECO:0000269|PubMed:31645732, ECO:0000269|PubMed:8945521, ECO:0000305|PubMed:20955178}.; FUNCTION: (Microbial infection) In case of HIV-1 infection, it is recruited by the viral protein Tat. Regulates Tat's transactivating activity and may help inducing chromatin remodeling of proviral genes. Binds to and may be involved in the transforming capacity of the adenovirus E1A protein. {ECO:0000269|PubMed:10545121, ECO:0000269|PubMed:11080476}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000263253, | ENST00000497559, ENST00000301923, ENST00000335727, ENST00000402203, ENST00000454349, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 20 X 17 X 12=4080 | 16 X 20 X 6=1920 |
| # samples | 29 | 22 | |
| ** MAII score | log2(29/4080*10)=-3.81444434684392 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(22/1920*10)=-3.12553088208386 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: EP300 [Title/Abstract] AND TNRC6B [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: EP300 [Title/Abstract] AND TNRC6B [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TNRC6B(40552186)-EP300(41572251), # samples:3 EP300(41489102)-TNRC6B(40642019), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. EP300-TNRC6B seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. EP300-TNRC6B seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. TNRC6B-EP300 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TNRC6B-EP300 seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. TNRC6B-EP300 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. TNRC6B-EP300 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. TNRC6B-EP300 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | EP300 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 10733570 |
| Hgene | EP300 | GO:0001666 | response to hypoxia | 9887100|15261140 |
| Hgene | EP300 | GO:0006110 | regulation of glycolytic process | 29775581 |
| Hgene | EP300 | GO:0006355 | regulation of transcription, DNA-templated | 15261140 |
| Hgene | EP300 | GO:0006473 | protein acetylation | 21030595|24939902 |
| Hgene | EP300 | GO:0006475 | internal protein amino acid acetylation | 18722353 |
| Hgene | EP300 | GO:0010742 | macrophage derived foam cell differentiation | 26504087 |
| Hgene | EP300 | GO:0010976 | positive regulation of neuron projection development | 27256286 |
| Hgene | EP300 | GO:0016573 | histone acetylation | 25818647|27256286 |
| Hgene | EP300 | GO:0018076 | N-terminal peptidyl-lysine acetylation | 12435739 |
| Hgene | EP300 | GO:0018393 | internal peptidyl-lysine acetylation | 17403783 |
| Hgene | EP300 | GO:0018394 | peptidyl-lysine acetylation | 23811396|23962722 |
| Hgene | EP300 | GO:0031333 | negative regulation of protein complex assembly | 23962722 |
| Hgene | EP300 | GO:0034644 | cellular response to UV | 24939902 |
| Hgene | EP300 | GO:0042771 | intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator | 17403783 |
| Hgene | EP300 | GO:0043627 | response to estrogen | 11581164 |
| Hgene | EP300 | GO:0043923 | positive regulation by host of viral transcription | 16687403 |
| Hgene | EP300 | GO:0043969 | histone H2B acetylation | 23415232 |
| Hgene | EP300 | GO:0045721 | negative regulation of gluconeogenesis | 30193097 |
| Hgene | EP300 | GO:0045815 | positive regulation of gene expression, epigenetic | 25818647 |
| Hgene | EP300 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 12586840|18722353|23811396 |
| Hgene | EP300 | GO:0051091 | positive regulation of DNA-binding transcription factor activity | 10518217|25818647 |
| Hgene | EP300 | GO:0060765 | regulation of androgen receptor signaling pathway | 18487222 |
| Hgene | EP300 | GO:0061921 | peptidyl-lysine propionylation | 17267393 |
| Hgene | EP300 | GO:0090043 | regulation of tubulin deacetylation | 18722353 |
| Hgene | EP300 | GO:0140066 | peptidyl-lysine crotonylation | 25818647 |
| Hgene | EP300 | GO:0140067 | peptidyl-lysine butyrylation | 17267393|29775581 |
| Hgene | EP300 | GO:1901224 | positive regulation of NIK/NF-kappaB signaling | 23811396 |
| Hgene | EP300 | GO:1905636 | positive regulation of RNA polymerase II regulatory region sequence-specific DNA binding | 23811396 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr22:40552186/chr22:41572251) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across EP300 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across TNRC6B (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000263253 | EP300 | chr22 | 41546202 | - | ENST00000301923 | TNRC6B | chr22 | 40681649 | + | 18522 | 4036 | 1219 | 5955 | 1578 |
| ENST00000263253 | EP300 | chr22 | 41546202 | - | ENST00000402203 | TNRC6B | chr22 | 40681649 | + | 6075 | 4036 | 1219 | 5955 | 1578 |
| ENST00000263253 | EP300 | chr22 | 41546202 | - | ENST00000454349 | TNRC6B | chr22 | 40681649 | + | 18522 | 4036 | 1219 | 5955 | 1578 |
| ENST00000263253 | EP300 | chr22 | 41546202 | - | ENST00000335727 | TNRC6B | chr22 | 40681649 | + | 18523 | 4036 | 1219 | 5955 | 1578 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000263253 | ENST00000301923 | EP300 | chr22 | 41546202 | - | TNRC6B | chr22 | 40681649 | + | 0.00109393 | 0.998906 |
| ENST00000263253 | ENST00000402203 | EP300 | chr22 | 41546202 | - | TNRC6B | chr22 | 40681649 | + | 0.010654632 | 0.9893454 |
| ENST00000263253 | ENST00000454349 | EP300 | chr22 | 41546202 | - | TNRC6B | chr22 | 40681649 | + | 0.00109393 | 0.998906 |
| ENST00000263253 | ENST00000335727 | EP300 | chr22 | 41546202 | - | TNRC6B | chr22 | 40681649 | + | 0.001096321 | 0.99890363 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for EP300-TNRC6B |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| EP300 | chr22 | 41546202 | TNRC6B | chr22 | 40681649 | 4036 | 884 | GPQSQALHPPPRQTPTPPTTQLPQQV |
Top |
Potential FusionNeoAntigen Information of EP300-TNRC6B in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| EP300-TNRC6B_41546202_40681649.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B48:01 | RQTPTPPTT | 0.9381 | 0.7848 | 11 | 20 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:06 | LHPPPRQTP | 0.9356 | 0.9232 | 6 | 15 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B08:09 | HPPPRQTPT | 0.8959 | 0.7828 | 7 | 16 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-A02:13 | ALHPPPRQT | 0.8184 | 0.7522 | 5 | 14 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:10 | LHPPPRQTP | 0.5486 | 0.6308 | 6 | 15 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B13:02 | RQTPTPPTT | 0.4884 | 0.9548 | 11 | 20 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:37 | LHPPPRQTP | 0.439 | 0.7158 | 6 | 15 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:13 | RQTPTPPTT | 0.2571 | 0.9769 | 11 | 20 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:05 | QTPTPPTTQL | 0.9012 | 0.5874 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:02 | QTPTPPTTQL | 0.8964 | 0.5799 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:03 | QTPTPPTTQL | 0.7577 | 0.8252 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B51:02 | QTPTPPTTQL | 0.7221 | 0.8143 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:04 | QTPTPPTTQL | 0.6389 | 0.9707 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:02 | QTPTPPTTQL | 0.6389 | 0.9707 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B81:01 | QTPTPPTTQL | 0.6332 | 0.6668 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B53:01 | QTPTPPTTQL | 0.5464 | 0.687 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B82:01 | QTPTPPTTQL | 0.4982 | 0.7608 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B48:01 | RQTPTPPTTQL | 0.9983 | 0.5934 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B81:01 | RQTPTPPTTQL | 0.9968 | 0.5206 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:05 | RQTPTPPTTQL | 0.992 | 0.6036 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:10 | RQTPTPPTTQL | 0.9912 | 0.6628 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:02 | RQTPTPPTTQL | 0.9889 | 0.6359 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B13:02 | RQTPTPPTTQL | 0.9671 | 0.8453 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B13:01 | RQTPTPPTTQL | 0.9561 | 0.9402 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B82:01 | RQTPTPPTTQL | 0.8959 | 0.569 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:13 | RQTPTPPTTQL | 0.8897 | 0.9059 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:03 | RQTPTPPTTQL | 0.8225 | 0.7054 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:09 | LHPPPRQTP | 0.7435 | 0.9321 | 6 | 15 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B78:01 | HPPPRQTPT | 0.3055 | 0.5695 | 7 | 16 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-C01:17 | QTPTPPTTQL | 0.9798 | 0.9778 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-C01:30 | QTPTPPTTQL | 0.9471 | 0.972 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:12 | QTPTPPTTQL | 0.9357 | 0.649 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:04 | QTPTPPTTQL | 0.7573 | 0.6104 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B56:04 | QTPTPPTTQL | 0.717 | 0.8082 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:12 | QTPTPPTTQL | 0.6389 | 0.9707 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B42:02 | QTPTPPTTQL | 0.6361 | 0.8444 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:10 | QTPTPPTTQL | 0.5714 | 0.9795 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B42:01 | QTPTPPTTQL | 0.5422 | 0.8339 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:04 | RQTPTPPTTQL | 0.9987 | 0.8015 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:04 | RQTPTPPTTQL | 0.9955 | 0.6611 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:12 | RQTPTPPTTQL | 0.9918 | 0.7092 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B48:03 | RQTPTPPTTQL | 0.983 | 0.5407 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:10 | RQTPTPPTTQL | 0.9807 | 0.8749 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:08 | RQTPTPPTTQL | 0.9757 | 0.9046 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B56:04 | RQTPTPPTTQL | 0.9231 | 0.7079 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B42:02 | RQTPTPPTTQL | 0.9036 | 0.7488 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B42:01 | RQTPTPPTTQL | 0.8816 | 0.7393 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-A02:03 | ALHPPPRQT | 0.8995 | 0.7559 | 5 | 14 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:09 | LHPPPRQTP | 0.3459 | 0.6685 | 6 | 15 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B78:02 | HPPPRQTPT | 0.2542 | 0.7174 | 7 | 16 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B48:05 | RQTPTPPTT | 0.2174 | 0.6859 | 11 | 20 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-C01:03 | QTPTPPTTQL | 0.9882 | 0.979 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-C01:02 | QTPTPPTTQL | 0.9857 | 0.9744 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:22 | QTPTPPTTQL | 0.8964 | 0.5799 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:09 | QTPTPPTTQL | 0.8905 | 0.5798 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B51:05 | QTPTPPTTQL | 0.8571 | 0.5215 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:26 | QTPTPPTTQL | 0.7826 | 0.5387 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-A68:02 | QTPTPPTTQL | 0.7523 | 0.7893 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:13 | QTPTPPTTQL | 0.7334 | 0.8272 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B56:02 | QTPTPPTTQL | 0.717 | 0.8082 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B55:04 | QTPTPPTTQL | 0.6807 | 0.8171 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:22 | QTPTPPTTQL | 0.6744 | 0.7456 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:09 | QTPTPPTTQL | 0.6389 | 0.9707 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B56:05 | QTPTPPTTQL | 0.6247 | 0.6346 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B67:01 | QTPTPPTTQL | 0.5561 | 0.972 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B51:06 | QTPTPPTTQL | 0.5392 | 0.6245 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-A69:01 | QTPTPPTTQL | 0.5367 | 0.8609 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B82:02 | QTPTPPTTQL | 0.4982 | 0.7608 | 12 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:68 | RQTPTPPTTQL | 0.9994 | 0.5908 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:54 | RQTPTPPTTQL | 0.9988 | 0.7265 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:73 | RQTPTPPTTQL | 0.9981 | 0.9049 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B15:30 | RQTPTPPTTQL | 0.9974 | 0.9108 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B48:05 | RQTPTPPTTQL | 0.996 | 0.5361 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:09 | RQTPTPPTTQL | 0.991 | 0.6319 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B07:22 | RQTPTPPTTQL | 0.9889 | 0.6359 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B40:12 | RQTPTPPTTQL | 0.983 | 0.5407 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B39:02 | RQTPTPPTTQL | 0.9816 | 0.8999 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B67:01 | RQTPTPPTTQL | 0.97 | 0.8331 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B40:21 | RQTPTPPTTQL | 0.9642 | 0.6241 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B55:04 | RQTPTPPTTQL | 0.9616 | 0.6592 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B56:02 | RQTPTPPTTQL | 0.9231 | 0.7079 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B82:02 | RQTPTPPTTQL | 0.8959 | 0.569 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:13 | RQTPTPPTTQL | 0.8214 | 0.7114 | 11 | 22 |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 | HLA-B35:22 | RQTPTPPTTQL | 0.8142 | 0.6384 | 11 | 22 |
Top |
Potential FusionNeoAntigen Information of EP300-TNRC6B in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of EP300-TNRC6B |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 5059 | LHPPPRQTPTPPTT | EP300 | TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 4036 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EP300-TNRC6B |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 5059 | LHPPPRQTPTPPTT | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 5059 | LHPPPRQTPTPPTT | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 5059 | LHPPPRQTPTPPTT | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 5059 | LHPPPRQTPTPPTT | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 5059 | LHPPPRQTPTPPTT | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 5059 | LHPPPRQTPTPPTT | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 5059 | LHPPPRQTPTPPTT | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 5059 | LHPPPRQTPTPPTT | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 5059 | LHPPPRQTPTPPTT | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 5059 | LHPPPRQTPTPPTT | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 5059 | LHPPPRQTPTPPTT | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of EP300-TNRC6B |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 11 | 20 | RQTPTPPTT | ACTCCAGGCGGTAGTCATGGTTTGTTT |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 11 | 22 | RQTPTPPTTQL | ACTCCAGGCGGTAGTCATGGTTTGTTTGGAAAC |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 12 | 22 | QTPTPPTTQL | CCAGGCGGTAGTCATGGTTTGTTTGGAAAC |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 5 | 14 | ALHPPPRQT | CTTCCTCCGCAGCCTGCAACTCCAGGC |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 6 | 15 | LHPPPRQTP | CCTCCGCAGCCTGCAACTCCAGGCGGT |
| EP300-TNRC6B | chr22 | 41546202 | chr22 | 40681649 | 7 | 16 | HPPPRQTPT | CCGCAGCCTGCAACTCCAGGCGGTAGT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of EP300-TNRC6B |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| LGG | EP300-TNRC6B | chr22 | 41546202 | ENST00000263253 | chr22 | 40681649 | ENST00000301923 | TCGA-HT-7480-01A |
Top |
Potential target of CAR-T therapy development for EP300-TNRC6B |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to EP300-TNRC6B |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to EP300-TNRC6B |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Hgene | EP300 | C0279626 | Squamous cell carcinoma of esophagus | 2 | CTD_human |
| Hgene | EP300 | C0001973 | Alcoholic Intoxication, Chronic | 1 | PSYGENET |
| Hgene | EP300 | C0005684 | Malignant neoplasm of urinary bladder | 1 | CTD_human |
| Hgene | EP300 | C0005695 | Bladder Neoplasm | 1 | CTD_human |
| Hgene | EP300 | C0006142 | Malignant neoplasm of breast | 1 | CGI;CTD_human;UNIPROT |
| Hgene | EP300 | C0007137 | Squamous cell carcinoma | 1 | CTD_human |
| Hgene | EP300 | C0007138 | Carcinoma, Transitional Cell | 1 | CTD_human |
| Hgene | EP300 | C0010606 | Adenoid Cystic Carcinoma | 1 | CTD_human |
| Hgene | EP300 | C0014170 | Endometrial Neoplasms | 1 | CTD_human |
| Hgene | EP300 | C0014518 | Toxic Epidermal Necrolysis | 1 | CTD_human |
| Hgene | EP300 | C0025202 | melanoma | 1 | CTD_human |
| Hgene | EP300 | C0028754 | Obesity | 1 | CTD_human |
| Hgene | EP300 | C0038325 | Stevens-Johnson Syndrome | 1 | CTD_human |
| Hgene | EP300 | C0079772 | T-Cell Lymphoma | 1 | CTD_human |
| Hgene | EP300 | C0149925 | Small cell carcinoma of lung | 1 | CTD_human |
| Hgene | EP300 | C0152013 | Adenocarcinoma of lung (disorder) | 1 | CTD_human |
| Hgene | EP300 | C0376634 | Craniofacial Abnormalities | 1 | CTD_human |
| Hgene | EP300 | C0476089 | Endometrial Carcinoma | 1 | CTD_human |
| Hgene | EP300 | C0678222 | Breast Carcinoma | 1 | CGI;CTD_human |
| Hgene | EP300 | C1257931 | Mammary Neoplasms, Human | 1 | CTD_human |
| Hgene | EP300 | C1274933 | Drug-Induced Stevens Johnson Syndrome | 1 | CTD_human |
| Hgene | EP300 | C1458155 | Mammary Neoplasms | 1 | CTD_human |
| Hgene | EP300 | C3150941 | RUBINSTEIN-TAYBI SYNDROME 2 | 1 | GENOMICS_ENGLAND |
| Hgene | EP300 | C3658301 | Mycoplasma-Induced Stevens-Johnson Syndrome | 1 | CTD_human |
| Hgene | EP300 | C3658302 | Stevens-Johnson Syndrome Toxic Epidermal Necrolysis Spectrum | 1 | CTD_human |
| Hgene | EP300 | C4704874 | Mammary Carcinoma, Human | 1 | CTD_human |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies