Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EPB41-YTHDF2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EPB41-YTHDF2
	FusionPDB ID: 26880
	FusionGDB2.0 ID: 26880
		Hgene	Tgene
	Gene symbol	EPB41	YTHDF2
	Gene ID	2035	51441
	Gene name	erythrocyte membrane protein band 4.1	YTH N6-methyladenosine RNA binding protein 2
	Synonyms	4.1R\|EL1\|HE	CAHL\|HGRG8\|NY-REN-2
	Cytomap	1p35.3	1p35.3
	Type of gene	protein-coding	protein-coding
	Description	protein 4.1EPB4.1P4.1band 4.1elliptocytosis 1, RH-linkederythrocyte surface protein band 4.1	YTH domain-containing family protein 29430020E02RikCLL-associated antigen KW-14YTH N(6)-methyladenosine RNA binding protein 2YTH domain family, member 2high-glucose-regulated protein 8renal carcinoma antigen NY-REN-2
	Modification date	20200320	20200313
	UniProtAcc	Q9HCM4 Main function of 5'-partner protein: FUNCTION: Plays a role in the formation and organization of tight junctions during the establishment of polarity in epithelial cells. {ECO:0000269\|PubMed:17920587}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000343067, ENST00000347529, ENST00000349460, ENST00000356093, ENST00000373797, ENST00000373798, ENST00000373800, ENST00000398863, ENST00000460378,	ENST00000478283, ENST00000541996, ENST00000373812, ENST00000542507,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 16 X 9=2592	10 X 8 X 8=640
	# samples	20	14
	** MAII score	log2(20/2592*10)=-3.6959938131099 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/640*10)=-2.1926450779424 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EPB41 [Title/Abstract] AND YTHDF2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EPB41 [Title/Abstract] AND YTHDF2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EPB41(29365938)-YTHDF2(29095441), # samples:1 EPB41(29213722)-YTHDF2(29068940), # samples:1 EPB41(29320054)-YTHDF2(29068915), # samples:1 EPB41(29220349)-YTHDF2(29068915), # samples:1
Anticipated loss of major functional domain due to fusion event.	EPB41-YTHDF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EPB41-YTHDF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EPB41-YTHDF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EPB41-YTHDF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EPB41-YTHDF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. EPB41-YTHDF2 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. EPB41-YTHDF2 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. EPB41-YTHDF2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	EPB41	GO:0032092	positive regulation of protein binding	3693401
Tgene	YTHDF2	GO:0006402	mRNA catabolic process	27558897\|30559377\|30930054
Tgene	YTHDF2	GO:0061157	mRNA destabilization	27558897\|30559377\|30930054
Tgene	YTHDF2	GO:1903679	positive regulation of cap-independent translational initiation	26458103

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:29365938/chr1:29095441)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EPB41 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across YTHDF2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000356093	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3238	808	7	2415	802
ENST00000356093	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3239	808	7	2415	802
ENST00000398863	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3238	808	7	2415	802
ENST00000398863	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3239	808	7	2415	802
ENST00000343067	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3238	808	7	2415	802
ENST00000343067	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3239	808	7	2415	802
ENST00000349460	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3285	855	606	2462	618
ENST00000349460	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3286	855	606	2462	618
ENST00000373800	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3268	838	589	2445	618
ENST00000373800	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3269	838	589	2445	618
ENST00000347529	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3157	727	46	2334	762
ENST00000347529	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3158	727	46	2334	762
ENST00000373798	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3215	785	104	2392	762
ENST00000373798	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3216	785	104	2392	762
ENST00000373797	EPB41	chr1	29320054	-	ENST00000542507	YTHDF2	chr1	29068915	+	3308	878	44	2485	813
ENST00000373797	EPB41	chr1	29320054	-	ENST00000373812	YTHDF2	chr1	29068915	+	3309	878	44	2485	813

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000356093	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000320956	0.9996791
ENST00000356093	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000324374	0.99967563
ENST00000398863	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000320956	0.9996791
ENST00000398863	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000324374	0.99967563
ENST00000343067	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000320956	0.9996791
ENST00000343067	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000324374	0.99967563
ENST00000349460	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000510309	0.99948967
ENST00000349460	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000515245	0.9994848
ENST00000373800	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000474726	0.9995253
ENST00000373800	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000479451	0.99952054
ENST00000347529	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000307847	0.9996922
ENST00000347529	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000311215	0.99968886
ENST00000373798	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000311511	0.9996885
ENST00000373798	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000314586	0.9996854
ENST00000373797	ENST00000542507	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000379575	0.99962044
ENST00000373797	ENST00000373812	EPB41	chr1	29320054	-	YTHDF2	chr1	29068915	+	0.000384172	0.9996158

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EPB41-YTHDF2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EPB41	chr1	29320054	YTHDF2	chr1	29068915	727	227	SLLDDTVYECVVENNAYTAMSDSYLP
EPB41	chr1	29320054	YTHDF2	chr1	29068915	785	227	SLLDDTVYECVVENNAYTAMSDSYLP
EPB41	chr1	29320054	YTHDF2	chr1	29068915	808	267	SLLDDTVYECVVENNAYTAMSDSYLP
EPB41	chr1	29320054	YTHDF2	chr1	29068915	838	83	SLLDDTVYECVVENNAYTAMSDSYLP
EPB41	chr1	29320054	YTHDF2	chr1	29068915	855	83	SLLDDTVYECVVENNAYTAMSDSYLP
EPB41	chr1	29320054	YTHDF2	chr1	29068915	878	278	SLLDDTVYECVVENNAYTAMSDSYLP

Top

Potential FusionNeoAntigen Information of EPB41-YTHDF2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EPB41-YTHDF2_29320054_29068915.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B45:01	VENNAYTA	0.9983	0.7317	11	19
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:01	VENNAYTA	0.9477	0.5416	11	19
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B41:01	VENNAYTA	0.8885	0.9147	11	19
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:01	VENNAYTAM	0.9713	0.8787	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B47:01	VENNAYTAM	0.9393	0.5845	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B35:08	ECVVENNAY	0.7594	0.8557	8	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B35:01	ECVVENNAY	0.6485	0.8872	8	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B39:13	VENNAYTAM	0.5344	0.9314	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B15:03	VENNAYTAM	0.3659	0.6676	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:01	YECVVENNA	0.3305	0.6796	7	16
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:01	VENNAYTAM	0.2628	0.5339	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:01	YECVVENNAY	0.9546	0.9373	7	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B40:06	VENNAYTA	0.9998	0.5531	11	19
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B40:06	YECVVENNA	0.982	0.5384	7	16
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B15:31	ECVVENNAY	0.701	0.8434	8	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B39:08	VENNAYTAM	0.643	0.8204	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:04	VENNAYTA	0.9477	0.5416	11	19
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:05	VENNAYTA	0.9477	0.5416	11	19
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B40:04	VENNAYTAM	0.9976	0.6859	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:04	VENNAYTAM	0.9815	0.9056	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:07	VENNAYTAM	0.9797	0.8339	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:05	VENNAYTAM	0.9713	0.8787	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:08	VENNAYTAM	0.9696	0.8442	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:06	VENNAYTAM	0.9648	0.892	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:03	VENNAYTAM	0.9214	0.867	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:11	VENNAYTAM	0.8441	0.814	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B35:23	ECVVENNAY	0.6528	0.855	8	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B35:77	ECVVENNAY	0.6485	0.8872	8	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B35:20	ECVVENNAY	0.6325	0.9111	8	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B35:24	ECVVENNAY	0.5405	0.9435	8	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B39:02	VENNAYTAM	0.5399	0.9343	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B15:53	VENNAYTAM	0.4387	0.8227	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B41:03	VENNAYTAM	0.4016	0.5025	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B48:02	VENNAYTAM	0.3903	0.8816	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:04	YECVVENNA	0.3305	0.6796	7	16
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:05	YECVVENNA	0.3305	0.6796	7	16
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:04	VENNAYTAM	0.2628	0.5339	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B50:05	VENNAYTAM	0.2628	0.5339	11	20
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:04	YECVVENNAY	0.9771	0.9429	7	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:08	YECVVENNAY	0.9597	0.8759	7	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:05	YECVVENNAY	0.9546	0.9373	7	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:06	YECVVENNAY	0.9508	0.9281	7	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:11	YECVVENNAY	0.9378	0.8639	7	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B18:03	YECVVENNAY	0.9195	0.9307	7	17
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	HLA-B35:20	YECVVENNAY	0.9006	0.9072	7	17

Top

Potential FusionNeoAntigen Information of EPB41-YTHDF2 in HLA II

EPB41-YTHDF2_29320054_29068915.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EPB41-YTHDF2	chr1	29320054	chr1	29068915	808	DRB1-1534	VENNAYTAMSDSYLP	11	26

Top

Fusion breakpoint peptide structures of EPB41-YTHDF2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10397	VYECVVENNAYTAM	EPB41	YTHDF2	chr1	29320054	chr1	29068915	808

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EPB41-YTHDF2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10397	VYECVVENNAYTAM	-6.24234	-6.35574
HLA-B14:02	3BVN	10397	VYECVVENNAYTAM	-4.03192	-5.06722
HLA-B52:01	3W39	10397	VYECVVENNAYTAM	-5.99175	-6.10515
HLA-B52:01	3W39	10397	VYECVVENNAYTAM	-4.7175	-5.7528
HLA-B18:01	4JQV	10397	VYECVVENNAYTAM	-5.37864	-5.49204
HLA-A11:01	4UQ2	10397	VYECVVENNAYTAM	-3.86601	-4.90131
HLA-A24:02	5HGA	10397	VYECVVENNAYTAM	-8.74828	-8.86168
HLA-A24:02	5HGA	10397	VYECVVENNAYTAM	-5.89703	-6.93233
HLA-B27:03	6PZ5	10397	VYECVVENNAYTAM	-2.25576	-2.36916
HLA-B44:05	3DX8	10397	VYECVVENNAYTAM	-7.38845	-7.50185
HLA-B44:05	3DX8	10397	VYECVVENNAYTAM	-4.09075	-5.12605
HLA-B35:01	1A1N	10397	VYECVVENNAYTAM	-5.04486	-5.15826
HLA-B35:01	1A1N	10397	VYECVVENNAYTAM	-3.85596	-4.89126

Top

Vaccine Design for the FusionNeoAntigens of EPB41-YTHDF2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EPB41-YTHDF2	chr1	29320054	chr1	29068915	11	19	VENNAYTA	GTGGAGAATAATGCATATACTGCC
EPB41-YTHDF2	chr1	29320054	chr1	29068915	11	20	VENNAYTAM	GTGGAGAATAATGCATATACTGCCATG
EPB41-YTHDF2	chr1	29320054	chr1	29068915	7	16	YECVVENNA	TATGAATGTGTTGTGGAGAATAATGCA
EPB41-YTHDF2	chr1	29320054	chr1	29068915	7	17	YECVVENNAY	TATGAATGTGTTGTGGAGAATAATGCATAT
EPB41-YTHDF2	chr1	29320054	chr1	29068915	8	17	ECVVENNAY	GAATGTGTTGTGGAGAATAATGCATAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
EPB41-YTHDF2	chr1	29320054	chr1	29068915	11	26	VENNAYTAMSDSYLP	GTGGAGAATAATGCATATACTGCCATGTCAGATTCCTACTTACCC

Top

Information of the samples that have these potential fusion neoantigens of EPB41-YTHDF2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UCS	EPB41-YTHDF2	chr1	29320054	ENST00000343067	chr1	29068915	ENST00000373812	TCGA-N8-A4PI-01A

Top

Potential target of CAR-T therapy development for EPB41-YTHDF2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EPB41-YTHDF2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EPB41-YTHDF2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)