Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EPHA5-RUFY3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EPHA5-RUFY3
	FusionPDB ID: 26968
	FusionGDB2.0 ID: 26968
		Hgene	Tgene
	Gene symbol	EPHA5	RUFY3
	Gene ID	2044	79443
	Gene name	EPH receptor A5	FYVE and coiled-coil domain autophagy adaptor 1
	Synonyms	CEK7\|EHK-1\|EHK1\|EK7\|HEK7\|TYRO4	CATC2\|CTRCT18\|RUFY3\|ZFYVE7
	Cytomap	4q13.1-q13.2	3p21.31
	Type of gene	protein-coding	protein-coding
	Description	ephrin type-A receptor 5EPH homology kinase 1EPH-like kinase 7brain-specific kinaseepididymis secretory sperm binding proteinreceptor protein-tyrosine kinase HEK7tyrosine-protein kinase receptor EHK-1	FYVE and coiled-coil domain-containing protein 1FYVE and coiled-coil domain containing 1RUN and FYVE domain containing 3zinc finger FYVE domain-containing protein 7
	Modification date	20200313	20200313
	UniProtAcc	P54756 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase which binds promiscuously GPI-anchored ephrin-A family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Among GPI-anchored ephrin-A ligands, EFNA5 most probably constitutes the cognate/functional ligand for EPHA5. Functions as an axon guidance molecule during development and may be involved in the development of the retinotectal, entorhino-hippocampal and hippocamposeptal pathways. Together with EFNA5 plays also a role in synaptic plasticity in adult brain through regulation of synaptogenesis. In addition to its function in the nervous system, the interaction of EPHA5 with EFNA5 mediates communication between pancreatic islet cells to regulate glucose-stimulated insulin secretion (By similarity). {ECO:0000250}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000273854, ENST00000354839, ENST00000511294, ENST00000432638,	ENST00000512331, ENST00000226328, ENST00000381006, ENST00000417478, ENST00000502653, ENST00000536664,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 3 X 2=18	5 X 5 X 4=100
	# samples	3	5
	** MAII score	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(5/100*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EPHA5 [Title/Abstract] AND RUFY3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EPHA5 [Title/Abstract] AND RUFY3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EPHA5(66356095)-RUFY3(71628236), # samples:2
Anticipated loss of major functional domain due to fusion event.	EPHA5-RUFY3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EPHA5-RUFY3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EPHA5-RUFY3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EPHA5-RUFY3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:66356095/chr4:71628236)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EPHA5 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RUFY3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000273854	EPHA5	chr4	66356095	-	ENST00000417478	RUFY3	chr4	71628236	+	3652	2003	601	3165	854
ENST00000273854	EPHA5	chr4	66356095	-	ENST00000381006	RUFY3	chr4	71628236	+	4344	2003	601	3687	1028
ENST00000273854	EPHA5	chr4	66356095	-	ENST00000226328	RUFY3	chr4	71628236	+	5495	2003	601	3234	877
ENST00000273854	EPHA5	chr4	66356095	-	ENST00000536664	RUFY3	chr4	71628236	+	3273	2003	601	3234	877
ENST00000273854	EPHA5	chr4	66356095	-	ENST00000502653	RUFY3	chr4	71628236	+	4131	2003	601	3687	1028
ENST00000354839	EPHA5	chr4	66356095	-	ENST00000417478	RUFY3	chr4	71628236	+	3244	1595	193	2757	854
ENST00000354839	EPHA5	chr4	66356095	-	ENST00000381006	RUFY3	chr4	71628236	+	3936	1595	193	3279	1028
ENST00000354839	EPHA5	chr4	66356095	-	ENST00000226328	RUFY3	chr4	71628236	+	5087	1595	193	2826	877
ENST00000354839	EPHA5	chr4	66356095	-	ENST00000536664	RUFY3	chr4	71628236	+	2865	1595	193	2826	877
ENST00000354839	EPHA5	chr4	66356095	-	ENST00000502653	RUFY3	chr4	71628236	+	3723	1595	193	3279	1028
ENST00000511294	EPHA5	chr4	66356095	-	ENST00000417478	RUFY3	chr4	71628236	+	3804	2155	753	3317	854
ENST00000511294	EPHA5	chr4	66356095	-	ENST00000381006	RUFY3	chr4	71628236	+	4496	2155	753	3839	1028
ENST00000511294	EPHA5	chr4	66356095	-	ENST00000226328	RUFY3	chr4	71628236	+	5647	2155	753	3386	877
ENST00000511294	EPHA5	chr4	66356095	-	ENST00000536664	RUFY3	chr4	71628236	+	3425	2155	753	3386	877
ENST00000511294	EPHA5	chr4	66356095	-	ENST00000502653	RUFY3	chr4	71628236	+	4283	2155	753	3839	1028

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000273854	ENST00000417478	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.002409841	0.9975902
ENST00000273854	ENST00000381006	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.002736734	0.9972633
ENST00000273854	ENST00000226328	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.000359145	0.9996408
ENST00000273854	ENST00000536664	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.003606292	0.99639374
ENST00000273854	ENST00000502653	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.003871038	0.9961289
ENST00000354839	ENST00000417478	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.002546578	0.9974534
ENST00000354839	ENST00000381006	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.001969516	0.9980305
ENST00000354839	ENST00000226328	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.000329795	0.99967027
ENST00000354839	ENST00000536664	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.003914627	0.9960854
ENST00000354839	ENST00000502653	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.003036112	0.9969639
ENST00000511294	ENST00000417478	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.002882432	0.99711764
ENST00000511294	ENST00000381006	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.003662748	0.9963373
ENST00000511294	ENST00000226328	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.000402924	0.99959713
ENST00000511294	ENST00000536664	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.004623877	0.9953761
ENST00000511294	ENST00000502653	EPHA5	chr4	66356095	-	RUFY3	chr4	71628236	+	0.005092986	0.99490696

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EPHA5-RUFY3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EPHA5	chr4	66356095	RUFY3	chr4	71628236	1595	466	ARQYVSVNVTTNQADPNYLMANERMN
EPHA5	chr4	66356095	RUFY3	chr4	71628236	2003	466	ARQYVSVNVTTNQADPNYLMANERMN
EPHA5	chr4	66356095	RUFY3	chr4	71628236	2155	466	ARQYVSVNVTTNQADPNYLMANERMN

Top

Potential FusionNeoAntigen Information of EPHA5-RUFY3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EPHA5-RUFY3_66356095_71628236.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:01	NQADPNYL	0.9884	0.7882	11	19
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:01	NQADPNYLM	0.9632	0.7682	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:13	NQADPNYLM	0.9427	0.7835	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B38:02	NQADPNYLM	0.8954	0.8321	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:17	TTNQADPNY	0.878	0.8145	9	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B38:01	NQADPNYLM	0.8476	0.8188	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B13:01	NQADPNYLM	0.8394	0.7942	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:03	NQADPNYLM	0.8094	0.6585	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:18	NQADPNYLM	0.7644	0.6006	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C04:10	QADPNYLM	1	0.8999	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:15	QADPNYLM	1	0.9768	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C05:09	QADPNYLM	1	0.9645	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C04:07	QADPNYLM	1	0.9202	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C04:06	QADPNYLM	0.9997	0.9513	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:04	QADPNYLM	0.9976	0.9872	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:13	QADPNYLM	0.9976	0.9872	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:03	QADPNYLM	0.9867	0.9898	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:05	NQADPNYL	0.9261	0.7718	11	19
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C05:09	QADPNYLMA	0.9996	0.9402	12	21
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:15	QADPNYLMA	0.9972	0.9845	12	21
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:03	NQADPNYLM	0.9585	0.9671	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:12	NQADPNYLM	0.9512	0.7736	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:21	NQADPNYLM	0.9184	0.8784	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:31	NQADPNYLM	0.9005	0.7818	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:05	NQADPNYLM	0.8803	0.7499	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:08	NQADPNYLM	0.8388	0.6186	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:31	TTNQADPNY	0.7641	0.8266	9	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B14:03	NQADPNYLM	0.6042	0.6967	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:03	QADPNYLMA	0.3629	0.9943	12	21
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C18:01	QADPNYLM	1	0.913	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C05:01	QADPNYLM	1	0.9645	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C04:03	QADPNYLM	1	0.9339	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C04:01	QADPNYLM	1	0.9202	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:02	QADPNYLM	1	0.9768	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:01	QADPNYLM	0.9867	0.9898	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:11	NQADPNYL	0.9645	0.5831	11	19
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B07:13	QADPNYLM	0.8281	0.8202	12	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C05:01	QADPNYLMA	0.9996	0.9402	12	21
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:02	QADPNYLMA	0.9972	0.9845	12	21
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:02	NQADPNYLM	0.9721	0.7821	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:31	NQADPNYLM	0.9669	0.769	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:01	NQADPNYLM	0.9585	0.9671	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:53	NQADPNYLM	0.9521	0.7373	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:12	NQADPNYLM	0.9339	0.7706	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B35:28	NQADPNYLM	0.8838	0.8433	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B35:20	NQADPNYLM	0.8821	0.8591	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C07:22	NQADPNYLM	0.8811	0.6296	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:73	NQADPNYLM	0.8789	0.7415	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:54	NQADPNYLM	0.8702	0.7047	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B38:05	NQADPNYLM	0.8476	0.8188	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B39:11	NQADPNYLM	0.8207	0.5675	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B15:30	NQADPNYLM	0.8077	0.8061	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B48:02	NQADPNYLM	0.8042	0.8113	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B18:04	NQADPNYLM	0.7814	0.8396	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-B18:06	NQADPNYLM	0.6184	0.8306	11	20
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	HLA-C08:01	QADPNYLMA	0.3629	0.9943	12	21

Top

Potential FusionNeoAntigen Information of EPHA5-RUFY3 in HLA II

EPHA5-RUFY3_66356095_71628236.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0401	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0403	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0405	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0407	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0409	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0411	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0411	QYVSVNVTTNQADPN	2	17
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0411	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0411	VSVNVTTNQADPNYL	4	19
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0417	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0417	QYVSVNVTTNQADPN	2	17
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0417	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0417	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0419	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0424	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0424	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0429	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0430	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0431	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0431	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0433	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0434	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0435	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0438	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0439	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0441	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0443	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0445	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0446	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0447	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0448	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0450	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0452	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0454	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0454	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0457	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0460	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0461	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0462	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0463	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0464	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0467	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0467	QYVSVNVTTNQADPN	2	17
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0469	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0469	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0471	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0472	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0474	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0475	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0476	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0477	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0480	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0482	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0483	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0484	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0485	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0486	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0486	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0487	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0488	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0489	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0491	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0491	QYVSVNVTTNQADPN	2	17
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0491	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0491	VSVNVTTNQADPNYL	4	19
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0813	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-0832	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1001	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1001	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1003	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1003	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1130	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1410	YVSVNVTTNQADPNY	3	18
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1410	QYVSVNVTTNQADPN	2	17
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB1-1446	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB3-0201	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB3-0204	RQYVSVNVTTNQADP	1	16
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB3-0215	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB3-0217	ARQYVSVNVTTNQAD	0	15
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2003	DRB3-0224	RQYVSVNVTTNQADP	1	16

Top

Fusion breakpoint peptide structures of EPHA5-RUFY3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10158	VNVTTNQADPNYLM	EPHA5	RUFY3	chr4	66356095	chr4	71628236	2003

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EPHA5-RUFY3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10158	VNVTTNQADPNYLM	-7.9962	-8.1096
HLA-B14:02	3BVN	10158	VNVTTNQADPNYLM	-5.70842	-6.74372
HLA-B52:01	3W39	10158	VNVTTNQADPNYLM	-6.83737	-6.95077
HLA-B52:01	3W39	10158	VNVTTNQADPNYLM	-4.4836	-5.5189
HLA-A11:01	4UQ2	10158	VNVTTNQADPNYLM	-10.0067	-10.1201
HLA-A11:01	4UQ2	10158	VNVTTNQADPNYLM	-9.03915	-10.0745
HLA-A24:02	5HGA	10158	VNVTTNQADPNYLM	-6.56204	-6.67544
HLA-A24:02	5HGA	10158	VNVTTNQADPNYLM	-5.42271	-6.45801
HLA-B44:05	3DX8	10158	VNVTTNQADPNYLM	-7.85648	-8.89178
HLA-B44:05	3DX8	10158	VNVTTNQADPNYLM	-5.3978	-5.5112
HLA-B35:01	1A1N	10158	VNVTTNQADPNYLM	-6.27422	-6.38762
HLA-B35:01	1A1N	10158	VNVTTNQADPNYLM	-5.27424	-6.30954
HLA-A02:01	6TDR	10158	VNVTTNQADPNYLM	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of EPHA5-RUFY3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EPHA5-RUFY3	chr4	66356095	chr4	71628236	11	19	NQADPNYL	AAGCAGATCCTAATTATCTCATGG
EPHA5-RUFY3	chr4	66356095	chr4	71628236	11	20	NQADPNYLM	AAGCAGATCCTAATTATCTCATGGCTA
EPHA5-RUFY3	chr4	66356095	chr4	71628236	12	20	QADPNYLM	CAGATCCTAATTATCTCATGGCTA
EPHA5-RUFY3	chr4	66356095	chr4	71628236	12	21	QADPNYLMA	CAGATCCTAATTATCTCATGGCTAATG
EPHA5-RUFY3	chr4	66356095	chr4	71628236	9	18	TTNQADPNY	CAAATCAAGCAGATCCTAATTATCTCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
EPHA5-RUFY3	chr4	66356095	chr4	71628236	0	15	ARQYVSVNVTTNQAD	GGCAGTATGTGTCTGTAAATGTAACCACAAATCAAGCAGATCCTA
EPHA5-RUFY3	chr4	66356095	chr4	71628236	1	16	RQYVSVNVTTNQADP	AGTATGTGTCTGTAAATGTAACCACAAATCAAGCAGATCCTAATT
EPHA5-RUFY3	chr4	66356095	chr4	71628236	2	17	QYVSVNVTTNQADPN	ATGTGTCTGTAAATGTAACCACAAATCAAGCAGATCCTAATTATC
EPHA5-RUFY3	chr4	66356095	chr4	71628236	3	18	YVSVNVTTNQADPNY	TGTCTGTAAATGTAACCACAAATCAAGCAGATCCTAATTATCTCA
EPHA5-RUFY3	chr4	66356095	chr4	71628236	4	19	VSVNVTTNQADPNYL	CTGTAAATGTAACCACAAATCAAGCAGATCCTAATTATCTCATGG

Top

Information of the samples that have these potential fusion neoantigens of EPHA5-RUFY3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	EPHA5-RUFY3	chr4	66356095	ENST00000273854	chr4	71628236	ENST00000226328	TCGA-91-6848-01A

Top

Potential target of CAR-T therapy development for EPHA5-RUFY3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EPHA5-RUFY3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EPHA5-RUFY3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)